Home |
Help |
Advanced search
2025-05-09 16:37:25, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_001077358 1869 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens phosphodiesterase 11A (PDE11A), transcript variant 2,
mRNA.
ACCESSION NM_001077358
VERSION NM_001077358.1 GI:116536088
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1869)
AUTHORS Vezzosi,D., Libe,R., Baudry,C., Rizk-Rabin,M., Horvath,A., Levy,I.,
Rene-Corail,F., Ragazzon,B., Stratakis,C.A., Vandecasteele,G. and
Bertherat,J.
TITLE Phosphodiesterase 11A (PDE11A) gene defects in patients with
acth-independent macronodular adrenal hyperplasia (AIMAH):
functional variants may contribute to genetic susceptibility of
bilateral adrenal tumors
JOURNAL J. Clin. Endocrinol. Metab. 97 (11), E2063-E2069 (2012)
PUBMED 22996146
REMARK GeneRIF: PDE11A genetic variants may increase predisposition to
ACTH-independent macronodular adrenal hyperplasia.
REFERENCE 2 (bases 1 to 1869)
AUTHORS Uckert,S., Oelke,M., Albrecht,K., Breitmeier,D., Kuczyk,M.A. and
Hedlund,P.
TITLE Expression and distribution of key enzymes of the cyclic GMP
signaling in the human clitoris: relation to phosphodiesterase type
5 (PDE5)
JOURNAL Int. J. Impot. Res. 23 (5), 206-212 (2011)
PUBMED 21697861
REMARK GeneRIF: found in single nerve trunks in the clitoral stroma
REFERENCE 3 (bases 1 to 1869)
AUTHORS Libe,R., Horvath,A., Vezzosi,D., Fratticci,A., Coste,J.,
Perlemoine,K., Ragazzon,B., Guillaud-Bataille,M., Groussin,L.,
Clauser,E., Raffin-Sanson,M.L., Siegel,J., Moran,J.,
Drori-Herishanu,L., Faucz,F.R., Lodish,M., Nesterova,M.,
Bertagna,X., Bertherat,J. and Stratakis,C.A.
TITLE Frequent phosphodiesterase 11A gene (PDE11A) defects in patients
with Carney complex (CNC) caused by PRKAR1A mutations: PDE11A may
contribute to adrenal and testicular tumors in CNC as a modifier of
the phenotype
JOURNAL J. Clin. Endocrinol. Metab. 96 (1), E208-E214 (2011)
PUBMED 21047926
REMARK GeneRIF: We demonstrate, in a large cohort of Carney Complex
patients, a high frequency of PDE11A variants, suggesting that
PDE11A is a genetic modifying factor for the development of
testicular and adrenal tumors in patients with germline PRKAR1A
mutation.
GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 1869)
AUTHORS Lango Allen,H., Estrada,K., Lettre,G., Berndt,S.I., Weedon,M.N.,
Rivadeneira,F., Willer,C.J., Jackson,A.U., Vedantam,S.,
Raychaudhuri,S., Ferreira,T., Wood,A.R., Weyant,R.J., Segre,A.V.,
Speliotes,E.K., Wheeler,E., Soranzo,N., Park,J.H., Yang,J.,
Gudbjartsson,D., Heard-Costa,N.L., Randall,J.C., Qi,L., Vernon
Smith,A., Magi,R., Pastinen,T., Liang,L., Heid,I.M., Luan,J.,
Thorleifsson,G., Winkler,T.W., Goddard,M.E., Sin Lo,K., Palmer,C.,
Workalemahu,T., Aulchenko,Y.S., Johansson,A., Zillikens,M.C.,
Feitosa,M.F., Esko,T., Johnson,T., Ketkar,S., Kraft,P., Mangino,M.,
Prokopenko,I., Absher,D., Albrecht,E., Ernst,F., Glazer,N.L.,
Hayward,C., Hottenga,J.J., Jacobs,K.B., Knowles,J.W., Kutalik,Z.,
Monda,K.L., Polasek,O., Preuss,M., Rayner,N.W., Robertson,N.R.,
Steinthorsdottir,V., Tyrer,J.P., Voight,B.F., Wiklund,F., Xu,J.,
Zhao,J.H., Nyholt,D.R., Pellikka,N., Perola,M., Perry,J.R.,
Surakka,I., Tammesoo,M.L., Altmaier,E.L., Amin,N., Aspelund,T.,
Bhangale,T., Boucher,G., Chasman,D.I., Chen,C., Coin,L.,
Cooper,M.N., Dixon,A.L., Gibson,Q., Grundberg,E., Hao,K., Juhani
Junttila,M., Kaplan,L.M., Kettunen,J., Konig,I.R., Kwan,T.,
Lawrence,R.W., Levinson,D.F., Lorentzon,M., McKnight,B.,
Morris,A.P., Muller,M., Suh Ngwa,J., Purcell,S., Rafelt,S.,
Salem,R.M., Salvi,E., Sanna,S., Shi,J., Sovio,U., Thompson,J.R.,
Turchin,M.C., Vandenput,L., Verlaan,D.J., Vitart,V., White,C.C.,
Ziegler,A., Almgren,P., Balmforth,A.J., Campbell,H., Citterio,L.,
De Grandi,A., Dominiczak,A., Duan,J., Elliott,P., Elosua,R.,
Eriksson,J.G., Freimer,N.B., Geus,E.J., Glorioso,N., Haiqing,S.,
Hartikainen,A.L., Havulinna,A.S., Hicks,A.A., Hui,J., Igl,W.,
Illig,T., Jula,A., Kajantie,E., Kilpelainen,T.O., Koiranen,M.,
Kolcic,I., Koskinen,S., Kovacs,P., Laitinen,J., Liu,J., Lokki,M.L.,
Marusic,A., Maschio,A., Meitinger,T., Mulas,A., Pare,G.,
Parker,A.N., Peden,J.F., Petersmann,A., Pichler,I.,
Pietilainen,K.H., Pouta,A., Ridderstrale,M., Rotter,J.I.,
Sambrook,J.G., Sanders,A.R., Schmidt,C.O., Sinisalo,J., Smit,J.H.,
Stringham,H.M., Bragi Walters,G., Widen,E., Wild,S.H.,
Willemsen,G., Zagato,L., Zgaga,L., Zitting,P., Alavere,H.,
Farrall,M., McArdle,W.L., Nelis,M., Peters,M.J., Ripatti,S., van
Meurs,J.B., Aben,K.K., Ardlie,K.G., Beckmann,J.S., Beilby,J.P.,
Bergman,R.N., Bergmann,S., Collins,F.S., Cusi,D., den Heijer,M.,
Eiriksdottir,G., Gejman,P.V., Hall,A.S., Hamsten,A., Huikuri,H.V.,
Iribarren,C., Kahonen,M., Kaprio,J., Kathiresan,S., Kiemeney,L.,
Kocher,T., Launer,L.J., Lehtimaki,T., Melander,O., Mosley,T.H. Jr.,
Musk,A.W., Nieminen,M.S., O'Donnell,C.J., Ohlsson,C., Oostra,B.,
Palmer,L.J., Raitakari,O., Ridker,P.M., Rioux,J.D., Rissanen,A.,
Rivolta,C., Schunkert,H., Shuldiner,A.R., Siscovick,D.S.,
Stumvoll,M., Tonjes,A., Tuomilehto,J., van Ommen,G.J., Viikari,J.,
Heath,A.C., Martin,N.G., Montgomery,G.W., Province,M.A., Kayser,M.,
Arnold,A.M., Atwood,L.D., Boerwinkle,E., Chanock,S.J., Deloukas,P.,
Gieger,C., Gronberg,H., Hall,P., Hattersley,A.T., Hengstenberg,C.,
Hoffman,W., Lathrop,G.M., Salomaa,V., Schreiber,S., Uda,M.,
Waterworth,D., Wright,A.F., Assimes,T.L., Barroso,I., Hofman,A.,
Mohlke,K.L., Boomsma,D.I., Caulfield,M.J., Cupples,L.A.,
Erdmann,J., Fox,C.S., Gudnason,V., Gyllensten,U., Harris,T.B.,
Hayes,R.B., Jarvelin,M.R., Mooser,V., Munroe,P.B., Ouwehand,W.H.,
Penninx,B.W., Pramstaller,P.P., Quertermous,T., Rudan,I.,
Samani,N.J., Spector,T.D., Volzke,H., Watkins,H., Wilson,J.F.,
Groop,L.C., Haritunians,T., Hu,F.B., Kaplan,R.C., Metspalu,A.,
North,K.E., Schlessinger,D., Wareham,N.J., Hunter,D.J.,
O'Connell,J.R., Strachan,D.P., Wichmann,H.E., Borecki,I.B., van
Duijn,C.M., Schadt,E.E., Thorsteinsdottir,U., Peltonen,L.,
Uitterlinden,A.G., Visscher,P.M., Chatterjee,N., Loos,R.J.,
Boehnke,M., McCarthy,M.I., Ingelsson,E., Lindgren,C.M.,
Abecasis,G.R., Stefansson,K., Frayling,T.M. and Hirschhorn,J.N.
TITLE Hundreds of variants clustered in genomic loci and biological
pathways affect human height
JOURNAL Nature 467 (7317), 832-838 (2010)
PUBMED 20881960
REFERENCE 5 (bases 1 to 1869)
AUTHORS DeWan,A.T., Triche,E.W., Xu,X., Hsu,L.I., Zhao,C., Belanger,K.,
Hellenbrand,K., Willis-Owen,S.A., Moffatt,M., Cookson,W.O.,
Himes,B.E., Weiss,S.T., Gauderman,W.J., Baurley,J.W., Gilliland,F.,
Wilk,J.B., O'Connor,G.T., Strachan,D.P., Hoh,J. and Bracken,M.B.
TITLE PDE11A associations with asthma: results of a genome-wide
association scan
JOURNAL J. Allergy Clin. Immunol. 126 (4), 871-873 (2010)
PUBMED 20920776
REMARK GeneRIF: PDE11A SNP assocaited with allergic asthma.
GeneRIF: Observational study and genome-wide association study of
gene-disease association. (HuGE Navigator)
REFERENCE 6 (bases 1 to 1869)
AUTHORS Hetman,J.M., Robas,N., Baxendale,R., Fidock,M., Phillips,S.C.,
Soderling,S.H. and Beavo,J.A.
TITLE Cloning and characterization of two splice variants of human
phosphodiesterase 11A
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (23), 12891-12895 (2000)
PUBMED 11050148
REFERENCE 7 (bases 1 to 1869)
AUTHORS Yuasa,K., Kotera,J., Fujishige,K., Michibata,H., Sasaki,T. and
Omori,K.
TITLE Isolation and characterization of two novel phosphodiesterase
PDE11A variants showing unique structure and tissue-specific
expression
JOURNAL J. Biol. Chem. 275 (40), 31469-31479 (2000)
PUBMED 10906126
REFERENCE 8 (bases 1 to 1869)
AUTHORS Fawcett,L., Baxendale,R., Stacey,P., McGrouther,C., Harrow,I.,
Soderling,S., Hetman,J., Beavo,J.A. and Phillips,S.C.
TITLE Molecular cloning and characterization of a distinct human
phosphodiesterase gene family: PDE11A
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3702-3707 (2000)
PUBMED 10725373
REFERENCE 9 (bases 1 to 1869)
AUTHORS Loughney,K., Martins,T.J., Harris,E.A., Sadhu,K., Hicks,J.B.,
Sonnenburg,W.K., Beavo,J.A. and Ferguson,K.
TITLE Isolation and characterization of cDNAs corresponding to two human
calcium, calmodulin-regulated, 3',5'-cyclic nucleotide
phosphodiesterases
JOURNAL J. Biol. Chem. 271 (2), 796-806 (1996)
PUBMED 8557689
REFERENCE 10 (bases 1 to 1869)
AUTHORS Beavo,J.A., Conti,M. and Heaslip,R.J.
TITLE Multiple cyclic nucleotide phosphodiesterases
JOURNAL Mol. Pharmacol. 46 (3), 399-405 (1994)
PUBMED 7935318
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from BX105579.1, AF281865.1 and
AC073834.6.
Summary: The 3',5'-cyclic nucleotides cAMP and cGMP function as
second messengers in a wide variety of signal transduction
pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs)
catalyze the hydrolysis of cAMP and cGMP to the corresponding
5'-monophosphates and provide a mechanism to downregulate cAMP and
cGMP signaling. This gene encodes a member of the PDE protein
superfamily. Mutations in this gene are a cause of Cushing disease
and adrenocortical hyperplasia. Multiple transcript variants
encoding different isoforms have been found for this gene.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) contains a distinct 5' UTR and
lacks an in-frame portion of the 5' coding region, compared to
variant 4. The resulting isoform (2) has a shorter N-terminus,
compared to isoform 4.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
CDS exon combination :: AF281865.1, HM771389.1 [ECO:0000331]
RNAseq introns :: mixed/partial sample support ERS025082,
ERS025083 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-42 BX105579.1 1-42
43-1822 AF281865.1 15-1794
1823-1869 AC073834.6 122495-122541 c
FEATURES Location/Qualifiers
source 1..1869
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q31.2"
gene 1..1869
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="phosphodiesterase 11A"
/db_xref="GeneID:50940"
/db_xref="HGNC:8773"
/db_xref="MIM:604961"
exon 1..130
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
misc_feature 98..100
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="upstream in-frame stop codon"
exon 131..220
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
CDS 134..1861
/gene="PDE11A"
/gene_synonym="PPNAD2"
/EC_number="3.1.4.35"
/EC_number="3.1.4.17"
/note="isoform 2 is encoded by transcript variant 2; cAMP
and cGMP cyclic nucleotide phosphodiesterase 11A; dual
3',5'-cyclic-AMP and -GMP phosphodiesterase 11A"
/codon_start=1
/product="dual 3',5'-cyclic-AMP and -GMP phosphodiesterase
11A isoform 2"
/protein_id="NP_001070826.1"
/db_xref="GI:116536089"
/db_xref="CCDS:CCDS46459.1"
/db_xref="GeneID:50940"
/db_xref="HGNC:8773"
/db_xref="MIM:604961"
/translation="
MQMYLPFCGIAISNAQLFAASRKEYERSRALLEVVNDLFEEQTDLEKIVKKIMHRAQTLLKCERCSVLLLEDIESPVVKFTKSFELMSPKCSADAENSFKESMEKSSYSDWLINNSIAELVASTGLPVNISDAYQDPRFDAEADQISGFHIRSVLCVPIWNSNHQIIGVAQVLNRLDGKPFDDADQRLFEAFVIFCGLGINNTIMYDQVKKSWAKQSVALDVLSYHATCSKAEVDKFKAANIPLVSELAIDDIHFDDFSLDVDAMITAALRMFMELGMVQKFKIDYETLCRWLLTVRKNYRMVLYHNWRHAFNVCQLMFAMLTTAGFQDILTEVEILAVIVGCLCHDLDHRGTNNAFQAKSGSALAQLYGTSATLEHHHFNHAVMILQSEGHNIFANLSSKEYSDLMQLLKQSILATDLTLYFERRTEFFELVSKGEYDWNIKNHRDIFRSMLMTACDLGAVTKPWEISRQVAELVTSEFFEQGDRERLELKLTPSAIFDRNRKDELPRLQLEWIDSICMPLYQALVKVNVKLKPMLDSVATNRSKWEELHQKRLLASTASSSPASVMVAKEDRN
"
misc_feature 221..769
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="FOG: GAF domain [Signal transduction mechanisms];
Region: FhlA; COG2203"
/db_xref="CDD:32385"
misc_feature 263..763
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="Domain present in phytochromes and cGMP-specific
phosphodiesterases; Region: GAF; smart00065"
/db_xref="CDD:197499"
misc_feature 1046..1576
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="Metal dependent phosphohydrolases with conserved
'HD' motif; Region: HDc; cd00077"
/db_xref="CDD:28958"
misc_feature order(1061..1063,1169..1174,1505..1507)
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="Zn2+ binding site [ion binding]; other site"
/db_xref="CDD:28958"
misc_feature 1172..1174
/gene="PDE11A"
/gene_synonym="PPNAD2"
/note="Mg2+ binding site [ion binding]; other site"
/db_xref="CDD:28958"
exon 221..361
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 230
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:78426895"
variation 292
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:77789692"
variation 302
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:74460362"
variation 310
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:76725221"
exon 362..426
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 386
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75920749"
exon 427..559
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 457
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="g"
/db_xref="dbSNP:78731210"
variation 499
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:77896877"
exon 560..635
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
exon 636..703
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
exon 704..796
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
exon 797..847
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 816
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:78384547"
exon 848..994
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 872
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:76110544"
variation 884
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:77934668"
variation 898
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:75157857"
exon 995..1102
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1032
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:77597060"
variation 1036
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="g"
/replace="t"
/db_xref="dbSNP:77341035"
variation 1093
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:78730670"
exon 1103..1212
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1145
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:74666005"
variation 1204
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:35194777"
exon 1213..1303
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1292
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:79840971"
exon 1304..1404
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1357
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:78690307"
exon 1405..1482
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1470
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:75127279"
exon 1483..1546
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
exon 1547..1621
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1556
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:75950476"
variation 1563
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="c"
/db_xref="dbSNP:75226037"
variation 1577
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/replace="t"
/db_xref="dbSNP:79903863"
exon 1622..1705
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1635
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79384192"
variation 1691
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:74357545"
exon 1706..1869
/gene="PDE11A"
/gene_synonym="PPNAD2"
/inference="alignment:Splign:1.39.8"
variation 1706
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:79400048"
variation 1724
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:75437575"
variation 1781
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="c"
/replace="t"
/db_xref="dbSNP:80129029"
variation 1822..1823
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace=""
/replace="tcc"
/db_xref="dbSNP:3830637"
variation 1838
/gene="PDE11A"
/gene_synonym="PPNAD2"
/replace="a"
/replace="g"
/db_xref="dbSNP:74326729"
ORIGIN
caagaaatgtagagggagaagagtgctggaagatgagtcaagaaaagtccactgtgtgttgggaatagattatgaagggctttgagtgtaggccctgtaagcaataggaagccatggaacagccagaaaggttatgcagatgtatcttccattttgtggaatcgccatatctaacgctcagctctttgctgcctcaaggaaagaatatgaaagaagcagagctttgctagaggtggttaatgacctctttgaagaacagactgacctggagaaaattgtcaagaaaataatgcatcgggcccaaactctgctgaaatgtgaacgctgttctgttttactcctagaggacatcgaatcaccagtggtgaaatttaccaaatcctttgaattgatgtccccaaagtgcagtgctgatgctgagaacagtttcaaagaaagcatggagaaatcatcatactccgactggctaataaataacagcattgctgagctggttgcttcaacaggccttccagtgaacatcagtgatgcctaccaggatccgcgctttgatgcagaggcagaccagatatctggttttcacataagatctgttctttgtgtccctatttggaatagcaaccaccaaataattggagtggctcaagtgttaaacagacttgatgggaaaccttttgatgatgcagatcaacgactttttgaggcttttgtcatcttttgtggacttggcatcaacaacacaattatgtatgatcaagtgaagaagtcctgggccaagcagtctgtggctcttgatgtgctatcataccatgcaacatgttcaaaagctgaagttgacaagtttaaggcagccaacatccctctggtgtcagaacttgccatcgatgacattcattttgatgacttttctctcgacgttgatgccatgatcacagctgctctccggatgttcatggagctggggatggtacagaaatttaaaattgactatgagacactgtgtaggtggcttttgacagtgaggaaaaactatcggatggttctataccacaactggagacatgccttcaacgtgtgtcagctgatgttcgcgatgttaaccactgctgggtttcaagacattctgaccgaggtggaaattttagcggtgattgtgggatgcctgtgtcatgacctcgaccacaggggaaccaacaatgccttccaagctaagagtggctctgccctggcccaactctatggaacctctgctaccttggagcatcaccatttcaaccacgccgtgatgatccttcaaagtgagggtcacaatatctttgctaacctgtcctccaaggaatatagtgaccttatgcagcttttgaagcagtcaatattggcaacagacctcacgctgtactttgagaggagaactgaattctttgaacttgtcagtaaaggagaatacgattggaacatcaaaaaccatcgtgatatatttcgatcaatgttaatgacagcctgtgaccttggagccgtgaccaaaccgtgggagatctccagacaggtggcagaacttgtaaccagtgagttcttcgaacaaggagatcgggagagattagagctcaaactcactccttcagcaatttttgatcggaaccggaaggatgaactgcctcggttgcaactggagtggattgatagcatctgcatgcctttgtatcaggcactggtgaaggtcaacgtgaaactgaagccgatgctagattcagtagctacaaacagaagtaagtgggaagagctacaccaaaaacgactgctggcctcaactgcctcatcctcccctgccagtgttatggtagccaaggaagacaggaactaaacctccag
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:50940 -> Molecular function: GO:0004112 [cyclic-nucleotide phosphodiesterase activity] evidence: NAS
GeneID:50940 -> Molecular function: GO:0004114 [3',5'-cyclic-nucleotide phosphodiesterase activity] evidence: TAS
GeneID:50940 -> Molecular function: GO:0004118 [cGMP-stimulated cyclic-nucleotide phosphodiesterase activity] evidence: IDA
GeneID:50940 -> Molecular function: GO:0030552 [cAMP binding] evidence: IEA
GeneID:50940 -> Molecular function: GO:0030553 [cGMP binding] evidence: IDA
GeneID:50940 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
GeneID:50940 -> Molecular function: GO:0047555 [3',5'-cyclic-GMP phosphodiesterase activity] evidence: IEA
GeneID:50940 -> Biological process: GO:0006198 [cAMP catabolic process] evidence: IEA
GeneID:50940 -> Biological process: GO:0007165 [signal transduction] evidence: IEA
GeneID:50940 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
GeneID:50940 -> Biological process: GO:0046069 [cGMP catabolic process] evidence: IEA
GeneID:50940 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
GeneID:50940 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:50940 -> Cellular component: GO:0043204 [perikaryon] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_001070826 -> EC 3.1.4.17
NP_001070826 -> EC 3.1.4.35
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.