GGRNA Home | Help | Advanced search

2025-09-18 02:56:43, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_001001877            1038 bp    mRNA    linear   PRI 17-MAR-2013
DEFINITION  Homo sapiens heat shock transcription factor, Y linked 2 (HSFY2),
            transcript variant 2, mRNA.
ACCESSION   NM_001001877
VERSION     NM_001001877.1  GI:50312658
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1038)
  AUTHORS   Shinka,T., Sato,Y., Chen,G., Naroda,T., Kinoshita,K., Unemi,Y.,
            Tsuji,K., Toida,K., Iwamoto,T. and Nakahori,Y.
  TITLE     Molecular characterization of heat shock-like factor encoded on the
            human Y chromosome, and implications for male infertility
  JOURNAL   Biol. Reprod. 71 (1), 297-306 (2004)
   PUBMED   15044259
REFERENCE   2  (bases 1 to 1038)
  AUTHORS   Tessari,A., Salata,E., Ferlin,A., Bartoloni,L., Slongo,M.L. and
            Foresta,C.
  TITLE     Characterization of HSFY, a novel AZFb gene on the Y chromosome
            with a possible role in human spermatogenesis
  JOURNAL   Mol. Hum. Reprod. 10 (4), 253-258 (2004)
   PUBMED   14985478
  REMARK    GeneRIF: Could have an important role in human spermatogenesis.
REFERENCE   3  (bases 1 to 1038)
  AUTHORS   Skaletsky,H., Kuroda-Kawaguchi,T., Minx,P.J., Cordum,H.S.,
            Hillier,L., Brown,L.G., Repping,S., Pyntikova,T., Ali,J., Bieri,T.,
            Chinwalla,A., Delehaunty,A., Delehaunty,K., Du,H., Fewell,G.,
            Fulton,L., Fulton,R., Graves,T., Hou,S.F., Latrielle,P.,
            Leonard,S., Mardis,E., Maupin,R., McPherson,J., Miner,T., Nash,W.,
            Nguyen,C., Ozersky,P., Pepin,K., Rock,S., Rohlfing,T., Scott,K.,
            Schultz,B., Strong,C., Tin-Wollam,A., Yang,S.P., Waterston,R.H.,
            Wilson,R.K., Rozen,S. and Page,D.C.
  TITLE     The male-specific region of the human Y chromosome is a mosaic of
            discrete sequence classes
  JOURNAL   Nature 423 (6942), 825-837 (2003)
   PUBMED   12815422
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC007379.2.
            
            Summary: This gene encodes a member of the heat shock factor (HSF)
            family of transcriptional activators for heat shock proteins. This
            gene is a candidate gene for azoospermia, since it localizes to a
            region of chromosome Y that is sometimes deleted in infertile
            males. The genome has two identical copies of this gene within a
            palindromic region; this record represents the more telomeric copy.
            Alternative splicing results in multiple transcript variants
            encoding distinct isoforms. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (2) includes a different exon in
            the 3' coding region, resulting in a frameshift and earlier
            termination codon, compared to variant 1. The resulting isoform (2)
            is shorter and has a distinct C-terminus compared to isoform 1.
            Isoform 2 lacks the HFS-type DNA-binding domain found in isoform 1.
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-610               AC007379.2         104010-104619       c
            611-1038            AC007379.2         62344-62771         c
FEATURES             Location/Qualifiers
     source          1..1038
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Y"
                     /map="Yq11.222"
     gene            1..1038
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="heat shock transcription factor, Y linked 2"
                     /db_xref="GeneID:159119"
                     /db_xref="HGNC:23950"
                     /db_xref="HPRD:13680"
     exon            1..610
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    74..76
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="upstream in-frame stop codon"
     CDS             98..709
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="isoform 2 is encoded by transcript variant 2; heat
                     shock transcription factor, Y-linked; heat shock
                     transcription factor 2-like protein"
                     /codon_start=1
                     /product="heat shock transcription factor, Y-linked
                     isoform 2"
                     /protein_id="NP_001001877.1"
                     /db_xref="GI:50312659"
                     /db_xref="CCDS:CCDS35476.1"
                     /db_xref="GeneID:159119"
                     /db_xref="HGNC:23950"
                     /db_xref="HPRD:13680"
                     /translation="
MAHVSSETQDVSPKDELTASEASTRSPLCEHTFPGDSDLRSMIEEHAFQVLSQGSLLESPSYTVCVSEPDKDDDFLSLNFPRKLWKIVESDQFKSISWDENGTCIVINEELFKKEILETKAPYRIFQTDAIKSFVRQLNLYGFSKIQQNFQRSAFLATFLSEEKESSVLSKIRFTKMKLSRSSTYENRYLCCNLHLKDESNYS
"
     misc_feature    335..>562
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /note="HSF-type DNA-binding; Region: HSF_DNA-bind;
                     pfam00447"
                     /db_xref="CDD:201233"
     exon            611..1038
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(887)
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112915209"
     polyA_site      1038
                     /gene="HSFY2"
                     /gene_synonym="HSF2L; HSFY"
ORIGIN      
taagtgtacatgcttaggccttctgaagcagcatttgaagctgcagtcctgaaaaccatgcaggccggaagagtagataaagaaatatttatttgagatggcacatgtttcttcagaaactcaagatgtttcccccaaagatgaattaactgcttcagaagcctccactaggtctccattgtgtgaacacaccttccctggggactcagacttacggtcaatgattgaagaacatgcttttcaggttttgtcacaaggatccttgttagaaagtccaagttacacagtttgtgtctctgagccagataaagatgatgattttctttctctgaactttcccaggaaactttggaaaatagtggaaagtgaccaattcaagtctatttcatgggatgagaatggaacttgcatagtgattaatgaagaactcttcaagaaagaaattttggaaacaaaggctccttacagaatatttcaaactgatgctatcaaaagttttgttcgacagctcaacctttatggatttagtaaaattcaacagaattttcaaagatctgcctttctagccacctttctgtcagaagagaaagaatcgtctgtcttaagcaagatacgcttcaccaaaatgaaactttccagatcttcaacttatgaaaacaggtatttatgttgcaacttacatttaaaagatgagtcgaattactcataatccttagaagttagcttgtccgcatctgaaaattcacttttaccttgaagttcaatctgtctctgggaaagactagattggaagaataaaattcaagaatgtgatgttttagtaatggaaaagccaagagcgtcaggtggcaaaagtccttctgttactcaagaaaatgctctgaaaaattccttttctcttttttttttgtaaagattaactccacctcaccaccacaatgaggtatttttctcagcaattgacacctgtttactcagttactccctgtaactatgttatgctgtgaagtaggcaatacagttgttaaagaagaataa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:159119 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:159119 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:159119 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:159119 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:159119 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.