Home |
Help |
Advanced search
2025-12-15 17:27:47, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_000326 1752 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens retinaldehyde binding protein 1 (RLBP1), mRNA.
ACCESSION NM_000326
VERSION NM_000326.4 GI:155029561
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1752)
AUTHORS Nojima,K., Hosono,K., Zhao,Y., Toshiba,T., Hikoya,A., Asai,T.,
Kato,M., Kondo,M., Minoshima,S. and Hotta,Y.
TITLE Clinical features of a Japanese case with Bothnia dystrophy
JOURNAL Ophthalmic Genet. 33 (2), 83-88 (2012)
PUBMED 22171637
REMARK GeneRIF: The clinical characteristics of a Japanese patient with a
homozygous R234W mutation in RLBP1 are very similar to that of
Swedish patients with Bothnia dystrophy.
REFERENCE 2 (bases 1 to 1752)
AUTHORS He,X., Lobsiger,J. and Stocker,A.
TITLE Molecular clues to Bothnia-type retinal dystrophy
JOURNAL Adv. Exp. Med. Biol. 723, 589-594 (2012)
PUBMED 22183382
REMARK GeneRIF: The R234W mutation reveals impaired 11-cis-retinal release
through stabilization of the ligand complex.
REFERENCE 3 (bases 1 to 1752)
AUTHORS Neutzner,R.V., Jager,M., Friedburg,C., Deeg,C.A. and Lorenz,B.
TITLE [Blind spot enlargement syndrome in acute zonal occult outer
retinopathy with detection of autoantibodies against the retinal
antigens CRALBP and S-Ag]
JOURNAL Ophthalmologe 108 (11), 1045-1049 (2011)
PUBMED 21904838
REMARK GeneRIF: Identification of autoantibodies specific for two retinal
antigens (CRALBP and S-Ag) supports the concept of an
autoimmunological origin of the disease.
REFERENCE 4 (bases 1 to 1752)
AUTHORS Naz,S., Ali,S., Riazuddin,S.A., Farooq,T., Butt,N.H., Zafar,A.U.,
Khan,S.N., Husnain,T., Macdonald,I.M., Sieving,P.A.,
Hejtmancik,J.F. and Riazuddin,S.
TITLE Mutations in RLBP1 associated with fundus albipunctatus in
consanguineous Pakistani families
JOURNAL Br J Ophthalmol 95 (7), 1019-1024 (2011)
PUBMED 21447491
REMARK GeneRIF: mutations in RLBP1 are responsible for fundus
albipunctatus in the affected individuals of these consanguineous
Pakistani families.
REFERENCE 5 (bases 1 to 1752)
AUTHORS Booij,J.C., Bakker,A., Kulumbetova,J., Moutaoukil,Y., Smeets,B.,
Verheij,J., Kroes,H.Y., Klaver,C.C., van Schooneveld,M.,
Bergen,A.A. and Florijn,R.J.
TITLE Simultaneous mutation detection in 90 retinal disease genes in
multiple patients using a custom-designed 300-kb retinal
resequencing chip
JOURNAL Ophthalmology 118 (1), 160-167 (2011)
PUBMED 20801516
REMARK GeneRIF: Observational study of genetic testing. (HuGE Navigator)
REFERENCE 6 (bases 1 to 1752)
AUTHORS Sarthy,V.
TITLE Cellular retinaldehyde-binding protein localization in cornea
JOURNAL Exp. Eye Res. 63 (6), 759-762 (1996)
PUBMED 9068383
REFERENCE 7 (bases 1 to 1752)
AUTHORS Dunn,K.C., Aotaki-Keen,A.E., Putkey,F.R. and Hjelmeland,L.M.
TITLE ARPE-19, a human retinal pigment epithelial cell line with
differentiated properties
JOURNAL Exp. Eye Res. 62 (2), 155-169 (1996)
PUBMED 8698076
REFERENCE 8 (bases 1 to 1752)
AUTHORS Intres,R., Goldflam,S., Cook,J.R. and Crabb,J.W.
TITLE Molecular cloning and structural analysis of the human gene
encoding cellular retinaldehyde-binding protein
JOURNAL J. Biol. Chem. 269 (41), 25411-25418 (1994)
PUBMED 7929238
REFERENCE 9 (bases 1 to 1752)
AUTHORS Sparkes,R.S., Heinzmann,C., Goldflam,S., Kojis,T., Saari,J.C.,
Mohandas,T., Klisak,I., Bateman,J.B. and Crabb,J.W.
TITLE Assignment of the gene (RLBP1) for cellular retinaldehyde-binding
protein (CRALBP) to human chromosome 15q26 and mouse chromosome 7
JOURNAL Genomics 12 (1), 58-62 (1992)
PUBMED 1733864
REFERENCE 10 (bases 1 to 1752)
AUTHORS Crabb,J.W., Goldflam,S., Harris,S.E. and Saari,J.C.
TITLE Cloning of the cDNAs encoding the cellular retinaldehyde-binding
protein from bovine and human retina and comparison of the protein
structures
JOURNAL J. Biol. Chem. 263 (35), 18688-18692 (1988)
PUBMED 3198595
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC124068.6.
This sequence is a reference standard in the RefSeqGene project.
On Aug 10, 2007 this sequence version replaced gi:38201694.
Summary: The protein encoded by this gene is a 36-kD water-soluble
protein which carries 11-cis-retinaldehyde or 11-cis-retinal as
physiologic ligands. It may be a functional component of the visual
cycle. Mutations of this gene have been associated with severe
rod-cone dystrophy, Bothnia dystrophy (nonsyndromic autosomal
recessive retinitis pigmentosa) and retinitis punctata albescens.
[provided by RefSeq, Jul 2008].
Sequence Note: The RefSeq transcript and protein were derived from
genomic sequence to make the sequence consistent with the reference
genome assembly. The genomic coordinates used for the transcript
record were based on alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: BC004199.2, AK312457.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025084 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-157 AC124068.6 55114-55270 c
158-280 AC124068.6 53316-53438 c
281-392 AC124068.6 52543-52654 c
393-521 AC124068.6 52144-52272 c
522-726 AC124068.6 50699-50903 c
727-905 AC124068.6 48639-48817 c
906-1064 AC124068.6 45322-45480 c
1065-1175 AC124068.6 44278-44388 c
1176-1752 AC124068.6 43446-44022 c
FEATURES Location/Qualifiers
source 1..1752
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="15"
/map="15q26"
gene 1..1752
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="retinaldehyde binding protein 1"
/db_xref="GeneID:6017"
/db_xref="HGNC:10024"
/db_xref="HPRD:01572"
/db_xref="MIM:180090"
exon 1..157
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 158..280
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 281..392
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
misc_feature 297..299
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="upstream in-frame stop codon"
variation 311
/gene="RLBP1"
/gene_synonym="CRALBP"
/replace="a"
/replace="g"
/db_xref="dbSNP:3743384"
CDS 381..1334
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="cellular retinaldehyde-binding protein-1"
/codon_start=1
/product="retinaldehyde-binding protein 1"
/protein_id="NP_000317.1"
/db_xref="GI:4506541"
/db_xref="CCDS:CCDS32324.1"
/db_xref="GeneID:6017"
/db_xref="HGNC:10024"
/db_xref="HPRD:01572"
/db_xref="MIM:180090"
/translation="
MSEGVGTFRMVPEEEQELRAQLEQLTTKDHGPVFGPCSQLPRHTLQKAKDELNEREETREEAVRELQEMVQAQAASGEELAVAVAERVQEKDSGFFLRFIRARKFNVGRAYELLRGYVNFRLQYPELFDSLSPEAVRCTIEAGYPGVLSSRDKYGRVVMLFNIENWQSQEITFDEILQAYCFILEKLLENEETQINGFCIIENFKGFTMQQAASLRTSDLRKMVDMLQDSFPARFKAIHFIHQPWYFTTTYNVVKPFLKSKLLERVFVHGDDLSGFYQEIDENILPSDFGGTLPKYDGKAVAEQLFGPQAQAENTAF
"
misc_feature 612..731
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="CRAL/TRIO, N-terminal domain; Region: CRAL_TRIO_N;
smart01100"
/db_xref="CDD:198168"
misc_feature 801..1256
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="Sec14p-like lipid-binding domain. Found in
secretory proteins, such as S. cerevisiae
phosphatidylinositol transfer protein (Sec14p), and in
lipid regulated proteins such as RhoGAPs, RhoGEFs and
neurofibromin (NF1). SEC14 domain of Dbl is known to...;
Region: SEC14; cd00170"
/db_xref="CDD:29115"
misc_feature order(849..851,855..857,861..863,939..941,984..986,
990..992,1038..1040,1050..1052,1062..1064,1074..1076,
1083..1085,1092..1094,1098..1100,1119..1121,1140..1142,
1176..1178)
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="phospholipid binding pocket [chemical binding];
other site"
/db_xref="CDD:29115"
misc_feature order(1077..1079,1173..1175)
/gene="RLBP1"
/gene_synonym="CRALBP"
/note="salt bridge; other site"
/db_xref="CDD:29115"
exon 393..521
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
STS 440..564
/gene="RLBP1"
/gene_synonym="CRALBP"
/standard_name="GDB:453389"
/db_xref="UniSTS:157413"
exon 522..726
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 727..905
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 906..1064
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 1065..1175
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
exon 1176..1752
/gene="RLBP1"
/gene_synonym="CRALBP"
/inference="alignment:Splign:1.39.8"
STS 1185..1351
/gene="RLBP1"
/gene_synonym="CRALBP"
/standard_name="RH17590"
/db_xref="UniSTS:24820"
STS 1375..1700
/gene="RLBP1"
/gene_synonym="CRALBP"
/standard_name="WI-7222"
/db_xref="UniSTS:49023"
variation 1501
/gene="RLBP1"
/gene_synonym="CRALBP"
/replace="g"
/replace="t"
/db_xref="dbSNP:834"
variation 1630
/gene="RLBP1"
/gene_synonym="CRALBP"
/replace="a"
/replace="g"
/db_xref="dbSNP:2710"
ORIGIN
gagcccgatttaacggaaactgtgggcggtgagaagttccttatgacacactaatcccaacctgctgaccggaccacgcctccagcggagggaacctctagagctccaggacattcaggtaccaggtagccccaaggaggagctgccgacctggcagggaacaaccaagactggggttaaatctcacagcctgcaagtggaagagaagaacttgaacccaggtccaacttttgcgccacagcaggctgcctcttggtcctgacaggaagtcacaacttggccctgacttcctatcctagggaaggggccggctggagaggccaggacagagaaagcagatcccttctttttccaaggactctgtgtcttccataggcaacatgtcagaaggggtgggcacgttccgcatggtacctgaagaggaacaggagctccgtgcccaactggagcagctcacaaccaaggaccatggacctgtctttggcccgtgcagccagctgccccgccacaccttgcagaaggccaaggatgagctgaacgagagagaggagacccgggaggaggcagtgcgagagctgcaggagatggtgcaggcgcaggcggcctcgggggaggagctggcggtggccgtggcggagagggtgcaagagaaggacagcggcttcttcctgcgcttcatccgcgcacggaagttcaacgtgggccgtgcctatgagctgctcagaggctatgtgaatttccggctgcagtaccctgagctctttgacagcctgtccccagaggctgtccgctgcaccattgaagctggctaccctggtgtcctctctagtcgggacaagtatggccgagtggtcatgctcttcaacattgagaactggcaaagtcaagaaatcacctttgatgagatcttgcaggcatattgcttcatcctggagaagctgctggagaatgaggaaactcaaatcaatggcttctgcatcattgagaacttcaagggctttaccatgcagcaggctgctagtctccggacttcagatctcaggaagatggtggacatgctccaggattccttcccagcccggttcaaagccatccacttcatccaccagccatggtacttcaccacgacctacaatgtggtcaagcccttcttgaagagcaagctgcttgagagggtctttgtccacggggatgacctttctggtttctaccaggagatcgatgagaacatcctgccctctgacttcgggggcacgctgcccaagtatgatggcaaggccgttgctgagcagctctttggcccccaggcccaagctgagaacacagccttctgaaaacatctcctgccagctgaactgtagttagaatctctgggcctctcctcaactgtcctggacccaaggctaggaaagggctgcttgagatgactgtggtccccccttagactccctaagcccgagtgagctcaggtgtcaccctgttctcaagttgggggatgggtaataaaggagggggaattcccttgaacaagaagaactggggatagttatatttccacctgcccttgaagctttaagacagtgatttttgtgtaaggttgtatttcaaagactcgaattcattttctcagtcatttcctttgtaacagagttttacgacttagagtctgtgaaaacaggcaaggagcccgggttaaaatatccccctattcgcccccaaaatgcaataaaagaagataaaagagagaggata
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:6017 -> Molecular function: GO:0005215 [transporter activity] evidence: IEA
GeneID:6017 -> Molecular function: GO:0005502 [11-cis retinal binding] evidence: IEA
GeneID:6017 -> Molecular function: GO:0019841 [retinol binding] evidence: IEA
GeneID:6017 -> Biological process: GO:0001523 [retinoid metabolic process] evidence: TAS
GeneID:6017 -> Biological process: GO:0006776 [vitamin A metabolic process] evidence: TAS
GeneID:6017 -> Biological process: GO:0007601 [visual perception] evidence: IEA
GeneID:6017 -> Biological process: GO:0007603 [phototransduction, visible light] evidence: TAS
GeneID:6017 -> Cellular component: GO:0005575 [cellular_component] evidence: ND
GeneID:6017 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:6017 -> Cellular component: GO:0044297 [cell body] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.