# [ GGRNA.v2 | 2024-04-28 00:57:45 ]
#
# seq:TCTCCACAAACGTTTTTAAAATGTG	4
# [INTERSECTION]	4
#
# accession	version	gi	length	symbol	synonym	geneid	division	source	definition	nt_position	aa_position
NM_032753	NM_032753.4		2162	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA.	1962	
NM_001319074	NM_001319074.4		2421	RAX2	ARMD6; CORD11; QRX; RAXL1; RP95	84839	RefSeq	Homo sapiens (human)	Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA.	2221	
XM_009434361	XM_009434361.4		2952	RAX2	RAXL1	468668	RefSeq	Pan troglodytes (chimpanzee)	PREDICTED: Pan troglodytes retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA.	2604	
XM_055103724	XM_055103724.1		6110	RAX2		100975671	RefSeq	Pan paniscus (pygmy chimpanzee)	PREDICTED: Pan paniscus retina and anterior neural fold homeobox 2 (RAX2), mRNA.	4531