# [ GGRNA.v2 | 2024-04-29 12:56:30 ] # # seq:GGGACACGGCAGTAAGCACAAGAAA 21 # [INTERSECTION] 21 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position XM_050770740 XM_050770740.1 2129 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1784 NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1814 XM_007994799 XM_007994799.2 2392 RAX2 103233693 RefSeq Chlorocebus sabaeus (Cercopithecus sabaeus) PREDICTED: Chlorocebus sabaeus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 2042 XM_011967344 XM_011967344.1 2114 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1769 XM_050770739 XM_050770739.1 2384 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2039 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 2073 XM_011967343 XM_011967343.1 2369 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2024 XM_017847250 XM_017847250.1 2121 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1772 XM_001100945 XM_001100945.4 2114 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1770 XM_009193161 XM_009193161.2 2123 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1778 XM_033200187 XM_033200187.1 2126 RAX2 117076548 RefSeq Trachypithecus francoisi (Francois's langur) PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1777 XM_010367273 XM_010367273.2 2132 RAX2 104665435 RefSeq Rhinopithecus roxellana (golden snub-nosed monkey) PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1783 XM_017847249 XM_017847249.1 2377 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2028 XM_002801027 XM_002801027.3 2371 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2027 XM_033200186 XM_033200186.1 2381 RAX2 117076548 RefSeq Trachypithecus francoisi (Francois's langur) PREDICTED: Trachypithecus francoisi retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2032 XM_010367272 XM_010367272.2 2382 RAX2 104665435 RefSeq Rhinopithecus roxellana (golden snub-nosed monkey) PREDICTED: Rhinopithecus roxellana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2033 XM_011747817 XM_011747817.2 2663 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 2319 XM_003914667 XM_003914667.2 2432 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2033 XM_011747810 XM_011747810.2 2918 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2574 XM_005587531 XM_005587531.2 3426 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1808 XM_015440231 XM_015440231.2 3711 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2093