# [ GGRNA.v2 | 2024-05-04 16:23:23 ] # # seq:GGCAGGAGCTGCAGTAGCTACCCTC 29 # [INTERSECTION] 29 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position XM_007994799 XM_007994799.2 2392 RAX2 103233693 RefSeq Chlorocebus sabaeus (Cercopithecus sabaeus) PREDICTED: Chlorocebus sabaeus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 1896 XM_011967344 XM_011967344.1 2114 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1622 XM_055371299 XM_055371299.1 2085 RAX2 129528844 RefSeq Gorilla gorilla gorilla (western lowland gorilla) PREDICTED: Gorilla gorilla gorilla retina and anterior neural fold homeobox 2 (RAX2), mRNA. 1580 XM_050770740 XM_050770740.1 2129 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1634 XM_011967343 XM_011967343.1 2369 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1877 XM_054465718 XM_054465718.1 2141 RAX2 129020846 RefSeq Pongo pygmaeus (Bornean orangutan) PREDICTED: Pongo pygmaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1636 XM_002828452 XM_002828452.4 2142 RAX2 100436730 RefSeq Pongo abelii (Sumatran orangutan) PREDICTED: Pongo abelii retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1637 NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1657 XM_001100945 XM_001100945.4 2114 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1620 XM_009193161 XM_009193161.2 2123 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1628 XM_025368382 XM_025368382.1 2115 RAX2 112613131 RefSeq Theropithecus gelada (gelada) PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1621 XM_050770739 XM_050770739.1 2384 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1889 XM_054465717 XM_054465717.1 2395 RAX2 129020846 RefSeq Pongo pygmaeus (Bornean orangutan) PREDICTED: Pongo pygmaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1890 XM_009252600 XM_009252600.3 2396 RAX2 100436730 RefSeq Pongo abelii (Sumatran orangutan) PREDICTED: Pongo abelii retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1891 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 1916 XM_004091072 XM_004091072.2 2329 RAX2 100588120 RefSeq Nomascus leucogenys (northern white-cheeked gibbon) PREDICTED: Nomascus leucogenys retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1847 XM_030796211 XM_030796211.1 2337 RAX2 100588120 RefSeq Nomascus leucogenys (northern white-cheeked gibbon) PREDICTED: Nomascus leucogenys retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1855 XM_002801027 XM_002801027.3 2371 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1877 XM_003914667 XM_003914667.2 2432 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1883 XM_055247316 XM_055247316.1 2667 LOC129465352 129465352 RefSeq Symphalangus syndactylus (siamang) PREDICTED: Symphalangus syndactylus retina and anterior neural fold homeobox protein 2-like (LOC129465352), mRNA. 2206 XM_025368381 XM_025368381.1 2372 RAX2 112613131 RefSeq Theropithecus gelada (gelada) PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1878 XM_009434361 XM_009434361.4 2952 RAX2 RAXL1 468668 RefSeq Pan troglodytes (chimpanzee) PREDICTED: Pan troglodytes retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2299 XM_058428734 XM_058428734.1 2968 RAX2 116482877 RefSeq Hylobates moloch (silvery gibbon) PREDICTED: Hylobates moloch retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 2471 XM_011747817 XM_011747817.2 2663 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 2169 XM_032176365 XM_032176365.2 3227 RAX2 116482877 RefSeq Hylobates moloch (silvery gibbon) PREDICTED: Hylobates moloch retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2730 XM_005587531 XM_005587531.2 3426 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1658 XM_011747810 XM_011747810.2 2918 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2424 XM_015440231 XM_015440231.2 3711 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1943 XM_055103724 XM_055103724.1 6110 RAX2 100975671 RefSeq Pan paniscus (pygmy chimpanzee) PREDICTED: Pan paniscus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 4226