# [ GGRNA.v2 | 2024-05-03 10:17:02 ] # # seq:AGAAGTGCGGCACCAGGGCAGGAGC 26 # [INTERSECTION] 26 # # accession version gi length symbol synonym geneid division source definition nt_position aa_position XM_055371299 XM_055371299.1 2085 RAX2 129528844 RefSeq Gorilla gorilla gorilla (western lowland gorilla) PREDICTED: Gorilla gorilla gorilla retina and anterior neural fold homeobox 2 (RAX2), mRNA. 1564 XM_007994799 XM_007994799.2 2392 RAX2 103233693 RefSeq Chlorocebus sabaeus (Cercopithecus sabaeus) PREDICTED: Chlorocebus sabaeus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 1880 XM_050770740 XM_050770740.1 2129 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1618 NM_032753 NM_032753.4 2162 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 2, mRNA. 1641 XM_011967344 XM_011967344.1 2114 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1606 XM_011943449 XM_011943449.1 2124 RAX2 105512828 RefSeq Colobus angolensis palliatus PREDICTED: Colobus angolensis palliatus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1609 XM_017847250 XM_017847250.1 2121 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1606 XM_050770739 XM_050770739.1 2384 RAX2 126942768 RefSeq Macaca thibetana thibetana PREDICTED: Macaca thibetana thibetana retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1873 NM_001319074 NM_001319074.4 2421 RAX2 ARMD6; CORD11; QRX; RAXL1; RP95 84839 RefSeq Homo sapiens (human) Homo sapiens retina and anterior neural fold homeobox 2 (RAX2), transcript variant 1, mRNA. 1900 XM_001100945 XM_001100945.4 2114 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1604 XM_009193161 XM_009193161.2 2123 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1612 XM_023200859 XM_023200859.3 2137 RAX2 111534229 RefSeq Piliocolobus tephrosceles (Ugandan red Colobus) PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1622 XM_025368382 XM_025368382.1 2115 RAX2 112613131 RefSeq Theropithecus gelada (gelada) PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1605 XM_011967343 XM_011967343.1 2369 RAX2 105530022 RefSeq Mandrillus leucophaeus (drill) PREDICTED: Mandrillus leucophaeus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1861 XM_011943448 XM_011943448.1 2381 RAX2 105512828 RefSeq Colobus angolensis palliatus PREDICTED: Colobus angolensis palliatus retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1866 XM_017847249 XM_017847249.1 2377 RAX2 108512134 RefSeq Rhinopithecus bieti (black snub-nosed monkey) PREDICTED: Rhinopithecus bieti retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1862 XM_002801027 XM_002801027.3 2371 RAX2 713929 RefSeq Macaca mulatta (Rhesus monkey) PREDICTED: Macaca mulatta retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1861 XM_023200858 XM_023200858.3 2392 RAX2 111534229 RefSeq Piliocolobus tephrosceles (Ugandan red Colobus) PREDICTED: Piliocolobus tephrosceles retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1877 XM_003914667 XM_003914667.2 2432 RAX2 100998831 RefSeq Papio anubis (olive baboon) PREDICTED: Papio anubis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1867 XM_025368381 XM_025368381.1 2372 RAX2 112613131 RefSeq Theropithecus gelada (gelada) PREDICTED: Theropithecus gelada retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1862 XM_009434361 XM_009434361.4 2952 RAX2 RAXL1 468668 RefSeq Pan troglodytes (chimpanzee) PREDICTED: Pan troglodytes retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2283 XM_011747817 XM_011747817.2 2663 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 2153 XM_005587531 XM_005587531.2 3426 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X2, mRNA. 1642 XM_011747810 XM_011747810.2 2918 RAX2 105485450 RefSeq Macaca nemestrina (pig-tailed macaque) PREDICTED: Macaca nemestrina retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 2408 XM_015440231 XM_015440231.2 3711 RAX2 102136169 RefSeq Macaca fascicularis (crab-eating macaque) PREDICTED: Macaca fascicularis retina and anterior neural fold homeobox 2 (RAX2), transcript variant X1, mRNA. 1927 XM_055103724 XM_055103724.1 6110 RAX2 100975671 RefSeq Pan paniscus (pygmy chimpanzee) PREDICTED: Pan paniscus retina and anterior neural fold homeobox 2 (RAX2), mRNA. 4210