GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:18:22, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus RNA polymerase II, I and III subunit H (Polr2h), mRNA. (808 bp)
accttggatgatggtgaatacaaccccacagacgacaggccttccagggctgaccagtttgagtatgtaatgtatgggaaagtgtacaggatcgaaggggacgagacctcaacggaagcagccacacgtctctctgcgtatgtgtcctatggcggcctcctcatgaggcttcagggggacgccaacaacctgcatggatttgaggtggactcccgagtctacctgctgatgaagaagctggcgttctgaacttccgggaaaccagccttgccgcttagtcactcgagccacggacattggtcaagcctgtgcacgagctgtttgcctgtagaagtgatggtgctctgtgtcctctgtggtacatcttcagcttctccgaattcagtggaaaaccgaccagtctgtaaaaggccaagtgggagagcctagcacgaacctgaagttgtattattattatttttttttaattaaagtttactttttcagactcttctcaaaaaaaaaaaaaaaaaa
position 473 482 499 507 515 560 568 589 597 616 639 647 655 694 704 718
Synonym: RGD1561203; RPB17
NM_001134789.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus DNA-directed RNA polymerases I, II, and III subunit RPABC3-like (LOC100912534), mRNA. (796 bp)
accttggatgatggtgaatacaaccccacagacgacaggccttccagggctgaccagtttgagtatgtaatgtatgggaaagtgtacaggatcgaaggggacgagacctcaacggaagcagccacacgtctctctgcgtatgtgtcctatggcggcctcctcatgaggcttcagggggacgccaacaacctgcatggatttgaggtggactcccgagtctacctgctgatgaagaagctggcgttctgaacttccgggaaaccagccttgccgcttagtcactcgagccacggacattggtcaagcctgtgcacgagctgtttgcctgtagaagtgatggtgctctgtgtcctctgtggtacatcttcagcttctccgaattcagtggaaaaccgaccagtctgtaaaaggccaagtgggagagcctagcacgaacctgaagttgtattattattatttttttttaattaaagtttactttttcaga
position 487 496 513 521 529 574 582 603 611 630 653 661 669 708 718 732
XM_003751083.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus DNA-directed RNA polymerases I, II, and III subunit RPABC3-like (LOC100912534), mRNA. (796 bp)
accttggatgatggtgaatacaaccccacagacgacaggccttccagggctgaccagtttgagtatgtaatgtatgggaaagtgtacaggatcgaaggggacgagacctcaacggaagcagccacacgtctctctgcgtatgtgtcctatggcggcctcctcatgaggcttcagggggacgccaacaacctgcatggatttgaggtggactcccgagtctacctgctgatgaagaagctggcgttctgaacttccgggaaaccagccttgccgcttagtcactcgagccacggacattggtcaagcctgtgcacgagctgtttgcctgtagaagtgatggtgctctgtgtcctctgtggtacatcttcagcttctccgaattcagtggaaaaccgaccagtctgtaaaaggccaagtgggagagcctagcacgaacctgaagttgtattattattatttttttttaattaaagtttactttttcaga
position 487 496 513 521 529 574 582 603 611 630 653 661 669 708 718 732
XM_017604371.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AI639518_g_at
lang : en | div : | spe : rn | query_string : rc_AI639518_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTGCCTGTAGAAGTGATGGTGCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.096 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGTGTCCTCTGTGGTACATCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.107 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACCTGCTGATGAAGAAGCTGGCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.116 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACATCTTCAGCTTCTCCGAATTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.128 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTGGACTCCCGAGTCTACCTGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.137 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTTAGTCACTCGAGCCACGGACAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.148 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTTGCCGCTTAGTCACTCGAGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.159 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGCCAACAACCTGCATGGATTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.168 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGTGGTACATCTTCAGCTTCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.178 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCGAGTCTACCTGCTGATGAAGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.189 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAAGCCTGTGCACGAGCTGTTTGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.201 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTCTGTAAAAGGCCAAGTGGGAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.212 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGCCAAGTGGGAGAGCCTAGCACG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.222 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCCTAGCACGAACCTGAAGTTGTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.233 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACATTGGTCAAGCCTGTGCACGAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.242 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCTGCATGGATTTGAGGTGGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.276 | 0.034 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTGCCTGTAGAAGTGATGGTGCTC)%26(nt:TCTGTGTCCTCTGTGGTACATCTTC)%26(nt:TACCTGCTGATGAAGAAGCTGGCGT)%26(nt:TACATCTTCAGCTTCTCCGAATTCA)%26(nt:GGTGGACTCCCGAGTCTACCTGCTG)%26(nt:GCTTAGTCACTCGAGCCACGGACAT)%26(nt:GCCTTGCCGCTTAGTCACTCGAGCC)%26(nt:GACGCCAACAACCTGCATGGATTTG)%26(nt:CTCTGTGGTACATCTTCAGCTTCTC)%26(nt:CCCGAGTCTACCTGCTGATGAAGAA)%26(nt:CAAGCCTGTGCACGAGCTGTTTGCC)%26(nt:AGTCTGTAAAAGGCCAAGTGGGAGA)%26(nt:AGGCCAAGTGGGAGAGCCTAGCACG)%26(nt:AGCCTAGCACGAACCTGAAGTTGTA)%26(nt:ACATTGGTCAAGCCTGTGCACGAGC)%26(nt:AACCTGCATGGATTTGAGGTGGACT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.279 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]