GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 22:57:47, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus RNA polymerase II, I and III subunit H (Polr2h), mRNA. (808 bp)
gaaggcaagaaatttgaccgagtatcccgtctgcattgtgagagtgaatctttcaagatggacctcatcttagatgtaaacattcagatttaccctgtagacttaggtgacaagttccggttggttatagctagtactttgtatgaagatggtaccttggatgatggtgaatacaaccccacagacgacaggccttccagggctgaccagtttgagtatgtaatgtatgggaaagtgtacaggatcgaaggggacgagacctcaacggaagcagccacacgtctctctgcgtatgtgtcctatggcggcctcctcatgaggcttcagggggacgccaacaacctgcatggatttgaggtggactcccgagtctacctgctgatgaagaagctggcgttctgaacttccgggaaaccagccttgccgcttagtcactcgagccacggacattggtcaagcctgtgcacgagctgtttgcctgtagaagtgatggtgctctgtgtcctctgtggtacatcttcagcttctccgaattcagtggaaaaccgaccagtctgtaaaaggccaagtgggagagcctagcacgaacctgaagttgta...
position 418 421 423 424 426 427 429 430 432 433 436 439 442 444 447 448
Synonym: RGD1561203; RPB17
NM_001134789.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AI639518_at
lang : en | div : | spe : rn | query_string : rc_AI639518_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTCCTATGGCGGCCTCCTCATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.103 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCGTATGTGTCCTATGGCGGCCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.113 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCTGCGTATGTGTCCTATGGCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.122 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCTCTGCGTATGTGTCCTATGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.287 | 0.165 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTCTCTGCGTATGTGTCCTATGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.300 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCCTATGGCGGCCTCCTCATGAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.313 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATGTGTCCTATGGCGGCCTCCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.322 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGGCCTCCTCATGAGGCTTCAGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.333 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCGTATGTGTCCTATGGCGGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.345 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGCGTATGTGTCCTATGGCGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.354 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTATGGCGGCCTCCTCATGAGGCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.366 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTATGTGTCCTATGGCGGCCTCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.378 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGCCTCCTCATGAGGCTTCAGGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.386 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACACGTCTCTCTGCGTATGTGTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.395 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGGCGGCCTCCTCATGAGGCTTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.406 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGTCTCTCTGCGTATGTGTCCTAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.427 | 0.022 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTCCTATGGCGGCCTCCTCATG)%26(nt:TGCGTATGTGTCCTATGGCGGCCTC)%26(nt:TCTCTGCGTATGTGTCCTATGGCGG)%26(nt:TCTCTCTGCGTATGTGTCCTATGGC)%26(nt:GTCTCTCTGCGTATGTGTCCTATGG)%26(nt:GTCCTATGGCGGCCTCCTCATGAGG)%26(nt:GTATGTGTCCTATGGCGGCCTCCTC)%26(nt:GCGGCCTCCTCATGAGGCTTCAGGG)%26(nt:CTGCGTATGTGTCCTATGGCGGCCT)%26(nt:CTCTGCGTATGTGTCCTATGGCGGC)%26(nt:CTATGGCGGCCTCCTCATGAGGCTT)%26(nt:CGTATGTGTCCTATGGCGGCCTCCT)%26(nt:CGGCCTCCTCATGAGGCTTCAGGGG)%26(nt:CACACGTCTCTCTGCGTATGTGTCC)%26(nt:ATGGCGGCCTCCTCATGAGGCTTCA)%26(nt:ACGTCTCTCTGCGTATGTGTCCTAT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.429 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]