GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 22:21:58, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus dedicator of cytokinesis 8 (Dock8), transcript variant X1, mRNA. (7344 bp)
cgttttccaaatcatctgtgagaggaagtcctacaggaagcctggtctcatgctggctgggaatctgggaatagatggatcgatcactctacaagctgctttttgcccctcctgcattgctggactgagtgccatctagttatctctgcgttgttgcttctgttaagctgagtgagcccacctttatccaggggacagttgtacaggacagtacagatcacccggccacacggcgctgacagcgcattccccagagcggaagcagttctcccagaacgttttgctggtttcctatacgcttgctctcactgtctcctttctcttctctgggataaggtgatttatttttttttatttttttttataggtgatttttatacaagggtaatactctgccttcgctccagaacattcgtcctctgtgtgctacaaaatatatgcttttgattctttttacagtgtattttaggaaaaagaaaaacaaagctatggtttgagaattaaattatatattttttcatacaactcacgaccttaacgaatactaaagatggaatacagacggcaagcaagtgggaagctggcacccacctttagtcc...
position 6871 6874 6876 6885 6887 6889 6892 6897 6899 6904 6906 6910 6918 6921 6924 6929
XM_008760310.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus dedicator of cytokinesis 8 (Dock8), mRNA. (7495 bp)
cgttttccaaatcatctgtgagaggaagtcctacaggaagcctggtctcatgctggctgggaatctgggaatagatggatcgatcactctacaagctgctttttgcccctcctgcattgctggactgagtgccatctagttatctctgcgttgttgcttctgttaagctgagtgagcccacctttatccaggggacagttgtacaggacagtacagatcacccggccacacggcgctgacagcgcattccccagagcggaagcagttctcccagaacgttttgctggtttcctatacgcttgctctcactgtctcctttctcttctctgggataaggtgatttatttttttttatttttttttataggtgatttttatacaagggtaatactctgccttcgctccagaacattcgtcctctgtgtgctacaaaatatatgcttttgattctttttacagtgtattttaggaaaaagaaaaacaaagctatggtttgagaattaaattatatattttttcatacaactcacgaccttaacgaatactaaagatggaatacagacggcaagcaagtgggaagctggcacccacctttagtcc...
position 7022 7025 7027 7036 7038 7040 7043 7048 7050 7055 7057 7061 7069 7072 7075 7080
NM_001037793.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AI639255_g_at
lang : en | div : | spe : rn | query_string : rc_AI639255_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.081 | 0.081 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTGCTGGTTTCCTATACGCTTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.090 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCCTATACGCTTGCTCTCACTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.098 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTCTCACTGTCTCCTTTCTCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.108 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCCTTTCTCTTCTCTGGGATAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.116 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCCCAGAACGTTTTGCTGGTTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.215 | 0.099 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCTATACGCTTGCTCTCACTGTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.223 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACGCTTGCTCTCACTGTCTCCTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.231 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTTGCTGGTTTCCTATACGCTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.240 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTCTCCCAGAACGTTTTGCTGGTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.246 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGGTTTCCTATACGCTTGCTCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.254 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGTTCTCCCAGAACGTTTTGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.260 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGTCTCCTTTCTCTTCTCTGGGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.270 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTTCTCTGGGATAAGGTGATTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.276 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTTGCTCTCACTGTCTCCTTTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.283 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTTTCTCTTCTCTGGGATAAGGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.289 | 0.006 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGTTTTGCTGGTTTCCTATACGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.323 | 0.033 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTGCTGGTTTCCTATACGCTTGCT)%26(nt:TTTCCTATACGCTTGCTCTCACTGT)%26(nt:TGCTCTCACTGTCTCCTTTCTCTTC)%26(nt:TCTCCTTTCTCTTCTCTGGGATAAG)%26(nt:TCTCCCAGAACGTTTTGCTGGTTTC)%26(nt:TCCTATACGCTTGCTCTCACTGTCT)%26(nt:TACGCTTGCTCTCACTGTCTCCTTT)%26(nt:GTTTTGCTGGTTTCCTATACGCTTG)%26(nt:GTTCTCCCAGAACGTTTTGCTGGTT)%26(nt:GCTGGTTTCCTATACGCTTGCTCTC)%26(nt:GCAGTTCTCCCAGAACGTTTTGCTG)%26(nt:CTGTCTCCTTTCTCTTCTCTGGGAT)%26(nt:CTCTTCTCTGGGATAAGGTGATTTA)%26(nt:CGCTTGCTCTCACTGTCTCCTTTCT)%26(nt:CCTTTCTCTTCTCTGGGATAAGGTG)%26(nt:ACGTTTTGCTGGTTTCCTATACGCT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.325 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]