GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:12:19, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus zinc finger and BTB domain containing 24 (Zbtb24), mRNA. (3769 bp)
tttgtcagataatgatacttgatttttatcaaaaagaagtcttagttacctggaactttaaagtttctcagtgtaccataagtcctaaatgcactgctgacttgtacttgagcgcagcattctgagttccgcgtccatcgtccatcgtaggactcctgcaggaagaactgggctctgtctgcatggccgtccaggttaaccccactccacaccgcttccttctgagcctcagagcgaaagcagccgcctgcgtccatgatggagggactttcaagccaacactaagttatgtctgggttctgttttcacgatcactgcactagttgaattcttggacttctcaggaagctggcggccttgcttgaggaaagagatagggtgctgggaacacggtgcaggggaccgtcggtgtgaactcgtgtcttcacagccgtcattcttcttcccttcgtgtattcccagccaaatccactatatttctgcaaattaaagaactagacaattcttcacattagcaagaacatttttgttctatatgcaccgagttgttttattagacataatttataaattgaataccaagttgtagatacggatcgg...
position 3160 3166 3172 3202 3256 3262 3280 3334 3340 3346 3352 3370 3454 3460 3490 3496
Synonym: Bif1a; ZNF450
NM_001098667.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AI638999_at
lang : en | div : | spe : rn | query_string : rc_AI638999_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCACGATCACTGCACTAGTTGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTGTTTTCACGATCACTGCACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.110 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTGAGCCTCAGAGCGAAAGCAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.120 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCACAGCCGTCATTCTTCTTCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCACTAGTTGAATTCTTGGACTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.141 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATTCCCAGCCAAATCCACTATATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.152 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACTTCTCAGGAAGCTGGCGGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.163 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTCAGAGCGAAAGCAGCCGCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.173 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATCACTGCACTAGTTGAATTCTTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.183 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTTCCGCGTCCATCGTCCATCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.194 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTGTCTTCACAGCCGTCATTCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.205 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCGTCCATCGTCCATCGTAGGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGCCTGCGTCCATGATGGAGGGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATCGTCCATCGTAGGACTCCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.235 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGCCAAATCCACTATATTTCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.246 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTGGGCTCTGTCTGCATGGCCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.270 | 0.024 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTCACGATCACTGCACTAGTTGAA)%26(nt:TTCTGTTTTCACGATCACTGCACTA)%26(nt:TTCTGAGCCTCAGAGCGAAAGCAGC)%26(nt:TTCACAGCCGTCATTCTTCTTCCCT)%26(nt:TGCACTAGTTGAATTCTTGGACTTC)%26(nt:TATTCCCAGCCAAATCCACTATATT)%26(nt:GGACTTCTCAGGAAGCTGGCGGCCT)%26(nt:GCCTCAGAGCGAAAGCAGCCGCCTG)%26(nt:GATCACTGCACTAGTTGAATTCTTG)%26(nt:GAGTTCCGCGTCCATCGTCCATCGT)%26(nt:CGTGTCTTCACAGCCGTCATTCTTC)%26(nt:CGCGTCCATCGTCCATCGTAGGACT)%26(nt:CCGCCTGCGTCCATGATGGAGGGAC)%26(nt:CATCGTCCATCGTAGGACTCCTGCA)%26(nt:CAGCCAAATCCACTATATTTCTGCA)%26(nt:AACTGGGCTCTGTCTGCATGGCCGT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.271 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]