GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:42:27, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus heterogeneous nuclear ribonucleoprotein A3-like (LOC100911361), misc_RNA. (1505 bp)
gacagcaacaatctaattatggacccatgaaggggggcagttttggtggaagaagctcaggcagtccctatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaa
position 1162 1192 1204 1210 1216 1246 1270 1276 1312 1336 1342 1354 1390 1402 1450 1462
XR_146195.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus heterogeneous nuclear ribonucleoprotein A3 (Hnrnpa3), transcript variant 1, mRNA. (5280 bp)
gacagcaacaatctaattatggacccatgaaggggggcagttttggtggaagaagctcaggcagtccctatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaattaaggaatttttaacttttcaatatttgtgtagttcagtttttctacattttagtacagaaactttaacaaaatgcagttttgaaggtgtttccttgtgagttaacaagta...
position 1237 1267 1279 1285 1291 1321 1345 1351 1387 1411 1417 1429 1465 1477 1525 1537
Synonym: Hnrpa3; mBx
NM_001111294.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus heterogeneous nuclear ribonucleoprotein A3 (Hnrnpa3), transcript variant X3, mRNA. (5138 bp)
gtggatatggtggtggaggaggaggatatgatggttacaatgaaggaggaaattttggtggaggtaactatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaattaaggaatttttaacttttcaatatttgtgtagttcagtttttctacattttagtacagaaactttaacaaaatgcagttttgaaggtgtttccttgtgagttaacaagta...
position 1121 1151 1163 1169 1175 1205 1229 1235 1271 1295 1301 1313 1349 1361 1409 1421
Synonym: Hnrpa3; mBx
XM_008761913.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus heterogeneous nuclear ribonucleoprotein A3 (Hnrnpa3), transcript variant X1, mRNA. (5207 bp)
gacagcaacaatctaattatggacccatgaaggggggcagttttggtggaagaagctcaggcagtccctatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaattaaggaatttttaacttttcaatatttgtgtagttcagtttttctacattttagtacagaaactttaacaaaatgcagttttgaaggtgtttccttgtgagttaacaagta...
position 1192 1222 1234 1240 1246 1276 1300 1306 1342 1366 1372 1384 1420 1432 1480 1492
Synonym: Hnrpa3; mBx
XM_008761911.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AI177683_at
lang : en | div : | spe : rn | query_string : rc_AI177683_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTCAGGAAAGCTGCAGGTTACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.098 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAGACAGTCGTCCTAAATGCATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.111 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTAGATGTACATTCCTGAGGTCTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.123 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGATCCATAGTCAGAAAAGTTACTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.134 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCCTGAGGTCTTTTATCTGTTGTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.146 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATAGCCACAGTTTGCAAAAGTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.157 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TATATTGCCCTGTAAATTGTGGTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.167 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTACTTTGAGACAGTCGTCCTAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.182 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAAGCCCTTCTTGTTCAGGACTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.193 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAACGATGATCCATAGTCAGAAAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.204 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCAGGTTACTTTGAGACAGTCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCACAGTTTGCAAAAGTGCAGCTAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.226 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATTACATCAGGTATATTGCCCTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.237 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAGTTCTTAGCAGGAGAGAGAGCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.248 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTGTAAAAATCTGCCACAGAAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.258 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAAGTGCAGCTATCGATTAATGCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.309 | 0.051 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTCAGGAAAGCTGCAGGTTACTT)%26(nt:TTGAGACAGTCGTCCTAAATGCATT)%26(nt:TTAGATGTACATTCCTGAGGTCTTT)%26(nt:TGATCCATAGTCAGAAAAGTTACTG)%26(nt:TCCTGAGGTCTTTTATCTGTTGTAG)%26(nt:TCATAGCCACAGTTTGCAAAAGTGC)%26(nt:TATATTGCCCTGTAAATTGTGGTAG)%26(nt:GTTACTTTGAGACAGTCGTCCTAAA)%26(nt:GGAAGCCCTTCTTGTTCAGGACTGT)%26(nt:GAACGATGATCCATAGTCAGAAAAG)%26(nt:CTGCAGGTTACTTTGAGACAGTCGT)%26(nt:CCACAGTTTGCAAAAGTGCAGCTAT)%26(nt:CATTACATCAGGTATATTGCCCTGT)%26(nt:ACAGTTCTTAGCAGGAGAGAGAGCG)%26(nt:AACTGTAAAAATCTGCCACAGAAGG)%26(nt:AAAGTGCAGCTATCGATTAATGCAA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.312 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]