GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:46:08, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus vav guanine nucleotide exchange factor 2 (Vav2), mRNA. (5164 bp)
gacccatccccagcccacccagtcagtggtactgctctttgcttgttgaagcccctttcctgagccaggaaacaggtcttttctgccctgctgccaggggggacacatctgtgaacctcgaagagcagggtagaaaaccaggttcccctccctgctcgctgtctcttttctctccgggaggcactcttgggtcttctgcactctaaaccatgctcactaggagtctgctggcctttgcactagatgttagtttgagcccttgtctggtatcccacaaggattcctgcaacccacacactgggcttatggccagctcaaaataagtgctcttgggggtctctgccctttcacttcttctcctggtgcttcctggcctttgacctctgcttgcttggccaaccctcttttcacccggtggagttctgagtggaagcttatgtgaagacacacacacagactcttgggccctttctcccctcatccagctgcccattcctggatgagtaggagccaaggttagggacactgtcccactgtcccactgtccccaacggagtggataatgcactacttgctcctggggacactttccagagttgg...
position 3984 3988 3992 3999 4002 4009 4012 4022 4029 4036 4039 4044 4049 4057 4060 4064
NM_001106563.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus vav guanine nucleotide exchange factor 2 (Vav2), transcript variant X3, mRNA. (5143 bp)
gacccatccccagcccacccagtcagtggtactgctctttgcttgttgaagcccctttcctgagccaggaaacaggtcttttctgccctgctgccaggggggacacatctgtgaacctcgaagagcagggtagaaaaccaggttcccctccctgctcgctgtctcttttctctccgggaggcactcttgggtcttctgcactctaaaccatgctcactaggagtctgctggcctttgcactagatgttagtttgagcccttgtctggtatcccacaaggattcctgcaacccacacactgggcttatggccagctcaaaataagtgctcttgggggtctctgccctttcacttcttctcctggtgcttcctggcctttgacctctgcttgcttggccaaccctcttttcacccggtggagttctgagtggaagcttatgtgaagacacacacacagactcttgggccctttctcccctcatccagctgcccattcctggatgagtaggagccaaggttagggacactgtcccactgtcccactgtccccaacggagtggataatgcactacttgctcctggggacactttccagagttgg...
position 3963 3967 3971 3978 3981 3988 3991 4001 4008 4015 4018 4023 4028 4036 4039 4043
XM_006233761.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus vav guanine nucleotide exchange factor 2 (Vav2), transcript variant X2, mRNA. (5158 bp)
gacccatccccagcccacccagtcagtggtactgctctttgcttgttgaagcccctttcctgagccaggaaacaggtcttttctgccctgctgccaggggggacacatctgtgaacctcgaagagcagggtagaaaaccaggttcccctccctgctcgctgtctcttttctctccgggaggcactcttgggtcttctgcactctaaaccatgctcactaggagtctgctggcctttgcactagatgttagtttgagcccttgtctggtatcccacaaggattcctgcaacccacacactgggcttatggccagctcaaaataagtgctcttgggggtctctgccctttcacttcttctcctggtgcttcctggcctttgacctctgcttgcttggccaaccctcttttcacccggtggagttctgagtggaagcttatgtgaagacacacacacagactcttgggccctttctcccctcatccagctgcccattcctggatgagtaggagccaaggttagggacactgtcccactgtcccactgtccccaacggagtggataatgcactacttgctcctggggacactttccagagttgg...
position 3978 3982 3986 3993 3996 4003 4006 4016 4023 4030 4033 4038 4043 4051 4054 4058
XM_017591643.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus vav guanine nucleotide exchange factor 2 (Vav2), transcript variant X1, mRNA. (5246 bp)
gacccatccccagcccacccagtcagtggtactgctctttgcttgttgaagcccctttcctgagccaggaaacaggtcttttctgccctgctgccaggggggacacatctgtgaacctcgaagagcagggtagaaaaccaggttcccctccctgctcgctgtctcttttctctccgggaggcactcttgggtcttctgcactctaaaccatgctcactaggagtctgctggcctttgcactagatgttagtttgagcccttgtctggtatcccacaaggattcctgcaacccacacactgggcttatggccagctcaaaataagtgctcttgggggtctctgccctttcacttcttctcctggtgcttcctggcctttgacctctgcttgcttggccaaccctcttttcacccggtggagttctgagtggaagcttatgtgaagacacacacacagactcttgggccctttctcccctcatccagctgcccattcctggatgagtaggagccaaggttagggacactgtcccactgtcccactgtccccaacggagtggataatgcactacttgctcctggggacactttccagagttgg...
position 4066 4070 4074 4081 4084 4091 4094 4104 4111 4118 4121 4126 4131 4139 4142 4146
XM_017591642.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA893593_g_at
lang : en | div : | spe : rn | query_string : rc_AA893593_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATGGCCAGCTCAAAATAAGTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.097 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCTCTTGGGGGTCTCTGCCCTTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.108 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAGCCCTTGTCTGGTATCCCACAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.118 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTATCCCACAAGGATTCCTGCAACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.127 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTTATGGCCAGCTCAAAATAAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.138 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCAGCTCAAAATAAGTGCTCTTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.181 | 0.043 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTGGGGGTCTCTGCCCTTTCACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.190 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGTATCCCACAAGGATTCCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.201 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCAAAATAAGTGCTCTTGGGGGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.210 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTTGTCTGGTATCCCACAAGGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.221 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACACTGGGCTTATGGCCAGCTCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.231 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAACCCACACACTGGGCTTATGGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.241 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTTTGAGCCCTTGTCTGGTATCCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.292 | 0.051 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGATTCCTGCAACCCACACACTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.301 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACAAGGATTCCTGCAACCCACACAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.311 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGTGCTCTTGGGGGTCTCTGCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.357 | 0.046 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTATGGCCAGCTCAAAATAAGTGCT)%26(nt:TGCTCTTGGGGGTCTCTGCCCTTTC)%26(nt:TGAGCCCTTGTCTGGTATCCCACAA)%26(nt:GTATCCCACAAGGATTCCTGCAACC)%26(nt:GGCTTATGGCCAGCTCAAAATAAGT)%26(nt:GCCAGCTCAAAATAAGTGCTCTTGG)%26(nt:CTTGGGGGTCTCTGCCCTTTCACTT)%26(nt:CTGGTATCCCACAAGGATTCCTGCA)%26(nt:CTCAAAATAAGTGCTCTTGGGGGTC)%26(nt:CCCTTGTCTGGTATCCCACAAGGAT)%26(nt:CACACTGGGCTTATGGCCAGCTCAA)%26(nt:CAACCCACACACTGGGCTTATGGCC)%26(nt:AGTTTGAGCCCTTGTCTGGTATCCC)%26(nt:AGGATTCCTGCAACCCACACACTGG)%26(nt:ACAAGGATTCCTGCAACCCACACAC)%26(nt:AAGTGCTCTTGGGGGTCTCTGCCCT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.361 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]