GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-06-15 19:38:19, GGRNA : RefSeq release 206 (May, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus thioredoxin-like 1 (Txnl1), mRNA. (1301 bp)
actgacagaagatgacattaaagaagatggcattgttcctcttcgttatgttaaatttcagaatgtgaacagtgtaactttgtttgttcagtctaatcaaggagaagaagaaacaacaagaatttcctattttactttcattggtactcccgtccaggcaacaaatatgaatgacttcaaacgagtagttggcaaaaagggggaaagccattagggtacaaaagacactggaagactactgcagtcagatttgcagctcctggataattgcttgattctcttcggaaactgttaatcttttatttgttgccagtaccaataaatcattgcttttgttcagatggtaatactagtgtttctattgtaatcttgatacatgcagttgtaaataaaagtcattactttgccaagcttaaaaaaaaaaaaaaaaaaaaaaaa
position 1085 1090 1096 1101 1105 1111 1115 1120 1128 1133 1137 1166 1175 1179 1191 1218
Synonym: Txnl
NM_080887.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus thioredoxin-like 1 (Txnl1), transcript variant X1, mRNA. (4269 bp)
cgttatgttaaatttcagaatgtgaacagtgtaactttgtttgttcagtctaatcaaggagaagaagaaacaacaagaatttcctattttactttcattggtactcccgtccaggcaacaaatatgaatgacttcaaacgaagaatacatattggcaagttgagagttgtcagcctgtgaaacagtagttggcaaaaagggggaaagccattagggtacaaaagacactggaagactactgcagtcagatttgcagctcctggataattgcttgattctcttcggaaactgttaatcttttatttgttgccagtaccaataaatcattgcttttgttcagatggtaatactagtgtttctattgtaatcttgatacatgcagttgtaaataaaagtcattactttgccaagcttaaatttttgtcattctgtataaatgcattctctctctttttatttgaacataggctaagcttttgttttagaagagttgttgactaaaagctagtctgtctctaaaggagcggaatgttgcaggacttgggagcactgtctatacatgtggagtgttttgatatggacttgagacatccgtatatg...
position 1156 1161 1167 1172 1176 1182 1186 1191 1199 1204 1208 1237 1246 1250 1262 1289
Synonym: Txnl
XM_006254827.4 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus thioredoxin-like 1 (Txnl1), transcript variant X2, misc_RNA. (5024 bp)
gaactcgaggccagtggaaggacatacggactaaacaccaggctgggttaaaacactaatgcagaagatcaatggattctttactgagtgaaagcctttaacatctaattgtgatgtacctagactttggtctctctggggtgtaatagaaagaattaagacagaataaaagagcttatgtggggtagttggcaaaaagggggaaagccattagggtacaaaagacactggaagactactgcagtcagatttgcagctcctggataattgcttgattctcttcggaaactgttaatcttttatttgttgccagtaccaataaatcattgcttttgttcagatggtaatactagtgtttctattgtaatcttgatacatgcagttgtaaataaaagtcattactttgccaagcttaaatttttgtcattctgtataaatgcattctctctctttttatttgaacataggctaagcttttgttttagaagagttgttgactaaaagctagtctgtctctaaaggagcggaatgttgcaggacttgggagcactgtctatacatgtggagtgttttgatatggacttgagacatccgtatatg...
position 1913 1918 1924 1929 1933 1939 1943 1948 1956 1961 1965 1994 2003 2007 2019 2046
Synonym: Txnl
XR_596963.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA875390_g_at
lang : en | div : | spe : rn | query_string : rc_AA875390_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTGTTGCCAGTACCAATAAATCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.098 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCTTTTGTTCAGATGGTAATACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.109 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCAGCTCCTGGATAATTGCTTGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.402 | 0.293 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAATTGCTTGATTCTCTTCGGAAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.412 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTTTCTATTGTAATCTTGATACATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.422 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCTTGATTCTCTTCGGAAACTGTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.432 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GATTTGCAGCTCCTGGATAATTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.444 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GATTCTCTTCGGAAACTGTTAATCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.455 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTCCTGGATAATTGCTTGATTCTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.467 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCAATAAATCATTGCTTTTGTTCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.477 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CAGTCAGATTTGCAGCTCCTGGATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.488 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGTACCAATAAATCATTGCTTTTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.498 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AGACTACTGCAGTCAGATTTGCAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.508 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACTGGAAGACTACTGCAGTCAGATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.518 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACTGCAGTCAGATTTGCAGCTCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.530 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGACACTGGAAGACTACTGCAGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.567 | 0.037 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TTTGTTGCCAGTACCAATAAATCAT)%26(nt:TGCTTTTGTTCAGATGGTAATACTA)%26(nt:TGCAGCTCCTGGATAATTGCTTGAT)%26(nt:TAATTGCTTGATTCTCTTCGGAAAC)%26(nt:GTTTCTATTGTAATCTTGATACATG)%26(nt:GCTTGATTCTCTTCGGAAACTGTTA)%26(nt:GATTTGCAGCTCCTGGATAATTGCT)%26(nt:GATTCTCTTCGGAAACTGTTAATCT)%26(nt:CTCCTGGATAATTGCTTGATTCTCT)%26(nt:CCAATAAATCATTGCTTTTGTTCAG)%26(nt:CAGTCAGATTTGCAGCTCCTGGATA)%26(nt:AGTACCAATAAATCATTGCTTTTGT)%26(nt:AGACTACTGCAGTCAGATTTGCAGC)%26(nt:ACTGGAAGACTACTGCAGTCAGATT)%26(nt:ACTGCAGTCAGATTTGCAGCTCCTG)%26(nt:AAGACACTGGAAGACTACTGCAGTC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.570 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]