GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:43:34, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus N-acetylglucosamine-1-phosphate transferase subunit gamma (Gnptg), mRNA. (1217 bp)
ttgctgagggcactttttgaggatgctggctacttaaaggtcccaggagaaacccaccccacccagctggcaggagattccaagggcctggggcttgagactctggacatttgcagaaaggcacacgcagagctgtcacgggaggtacaaagactgacaagtctgctcgaacagcatggaatcccacacactcagcccacagaaaccacccactctcagctcctgggtcagcagctcccggtaggtgaaatctcagagcagttgcggggcgacccaggactacgagggaacatcctgtgagccaggcggccatgaagaacagaaatgttctgagccttgagtgtcttttcagagagaggccaagtgtggtctcagcagagtgcaccaaactggtgtggtgtggacatggcttcttttggcatcttctaggccagacaatatcactgacaagagggacctgctggccagcctttgttgtgcccaaagatccagacaaaataaagattcgaagttttaattaattccatactcataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
position 783 792 871 907 963 971 982 991 997 1011 1017 1035 1042 1048 1061 1068
Synonym: Gnptag
NM_001100493.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus N-acetylglucosamine-1-phosphate transferase, gamma subunit (Gnptg), transcript variant X1, mRNA. (1282 bp)
aggagaaacccaccccacccagctggcaggagattccaagggcctggggcttgagactctggacatttgcagaaaggcacacgcagagctgtcacgggaggtacaaagactgacaagtctgctcgaacagcatggaatcccacacactcagcccacaggtcagtctgcctgccctggtaagctgccagccacacttgggcctgcagctctggggcagatctgtatcaatctctgttgttctggcagaaaccacccactctcagctcctgggtcagcagctcccggtaggtgaaatctcagagcagttgcggggcgacccaggactacgagggaacatcctgtgagccaggcggccatgaagaacagaaatgttctgagccttgagtgtcttttcagagagaggccaagtgtggtctcagcagagtgcaccaaactggtgtggtgtggacatggcttcttttggcatcttctaggccagacaatatcactgacaagagggacctgctggccagcctttgttgtgcccaaagatccagacaaaataaagattcgaagttttaattaattccatactc
position 809 818 985 1021 1077 1085 1096 1105 1111 1125 1131 1149 1156 1162 1175 1182
Synonym: Gnptag
XM_006245935.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA875171_g_at
lang : en | div : | spe : rn | query_string : rc_AA875171_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.097 | 0.097 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTTTGGCATCTTCTAGGCCAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.108 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTAGGCCAGACAATATCACTGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.127 | 0.019 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTTCTGAGCCTTGAGTGTCTTTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.138 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGACAAGTCTGCTCGAACAGCATGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.152 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACAAAGACTGACAAGTCTGCTCGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.162 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGTGGACATGGCTTCTTTTGGCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.172 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGCACCAAACTGGTGTGGTGTGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.182 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCCCGGTAGGTGAAATCTCAGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.193 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTTGAGTGTCTTTTCAGAGAGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.203 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGAGGCCAAGTGTGGTCTCAGCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.213 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTTCAGAGAGAGGCCAAGTGTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.230 | 0.017 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGACCCAGGACTACGAGGGAACATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.240 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAGACAATATCACTGACAAGAGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.250 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAAGTGTGGTCTCAGCAGAGTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.260 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATGGCTTCTTTTGGCATCTTCTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.271 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCAGAGTGCACCAAACTGGTGTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.294 | 0.023 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTTTGGCATCTTCTAGGCCAGA)%26(nt:TTCTAGGCCAGACAATATCACTGAC)%26(nt:TGTTCTGAGCCTTGAGTGTCTTTTC)%26(nt:TGACAAGTCTGCTCGAACAGCATGG)%26(nt:TACAAAGACTGACAAGTCTGCTCGA)%26(nt:GTGTGGACATGGCTTCTTTTGGCAT)%26(nt:GTGCACCAAACTGGTGTGGTGTGGA)%26(nt:GCTCCCGGTAGGTGAAATCTCAGAG)%26(nt:GCCTTGAGTGTCTTTTCAGAGAGAG)%26(nt:GAGAGGCCAAGTGTGGTCTCAGCAG)%26(nt:CTTTTCAGAGAGAGGCCAAGTGTGG)%26(nt:CGACCCAGGACTACGAGGGAACATC)%26(nt:CCAGACAATATCACTGACAAGAGGG)%26(nt:CCAAGTGTGGTCTCAGCAGAGTGCA)%26(nt:CATGGCTTCTTTTGGCATCTTCTAG)%26(nt:AGCAGAGTGCACCAAACTGGTGTGG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.296 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]