GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 22:38:48, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant 2, mRNA. (4379 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2142 2280 2292 2298 2304 2322 2328 2364 2412 2418 2454 2472 2478 2514 2562 2574
Synonym: P85spr; Pak3bp
NM_001113522.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant 1, mRNA. (4556 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2319 2457 2469 2475 2481 2499 2505 2541 2589 2595 2631 2649 2655 2691 2739 2751
Synonym: P85spr; Pak3bp
NM_001113521.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X6, mRNA. (4765 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2548 2686 2698 2704 2710 2728 2734 2770 2818 2824 2860 2878 2884 2920 2968 2980
Synonym: P85spr; Pak3bp
XM_039094100.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X3, mRNA. (4767 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2550 2688 2700 2706 2712 2730 2736 2772 2820 2826 2862 2880 2886 2922 2970 2982
Synonym: P85spr; Pak3bp
XM_039094098.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X4, mRNA. (4926 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2709 2847 2859 2865 2871 2889 2895 2931 2979 2985 3021 3039 3045 3081 3129 3141
Synonym: P85spr; Pak3bp
XM_039094099.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X2, mRNA. (5056 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2839 2977 2989 2995 3001 3019 3025 3061 3109 3115 3151 3169 3175 3211 3259 3271
Synonym: P85spr; Pak3bp
XM_008771380.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X1, mRNA. (5143 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 2926 3064 3076 3082 3088 3106 3112 3148 3196 3202 3238 3256 3262 3298 3346 3358
Synonym: P85spr; Pak3bp
XM_008771379.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X5, mRNA. (6031 bp)
tccagaagaagagaaaattatagtcgaagaaaccaaaagcaacgggcagacagtgatagaggaaaagagcctcgtggataccgtgtacgcactaaaggatgaagtccaagagttacgacaggataacaagaagatgaagaaatccttagaggaggaacagagggcccgcaaggacctagagaagctggtgaggaaggttctaaagaacatgaacgaccctgcttgggatgagaccaatctataggctgacttcattctcataggctgaagaccagcagctcctggacaaggctggggcccttggtccccagcacagtgacattcaggactaaggaggtggtcttcaaaaggcaagcagcagtgatgagctgttgctgaagtagctacatgtgagttctagacaccgaggcctgggctgagtgagcacctcgctgtacacctctccctgcagtgactgaccagagtcctcggctttgggacttgagttgaatctataaatagcttacctgtgtactccttgtaaatactgagatctgaatgaacatgtacctgagaggtgactaggctaaccctcttgctaggatttccttctcagccttt...
position 3814 3952 3964 3970 3976 3994 4000 4036 4084 4090 4126 4144 4150 4186 4234 4246
Synonym: P85spr; Pak3bp
XM_008771376.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA875133_at
lang : en | div : | spe : rn | query_string : rc_AA875133_at | format : html | download :

0.000 | 0.000 | search_start;
0.095 | 0.095 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGGTCCCCAGCACAGTGACATTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.106 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAGTTCTAGACACCGAGGCCTGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.115 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAGACCAATCTATAGGCTGACTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.125 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGCTTACCTGTGTACTCCTTGTAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.137 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACCGTGTACGCACTAAAGGATGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.307 | 0.170 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGACTGACCAGAGTCCTCGGCTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.320 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTACTCCTTGTAAATACTGAGATCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.330 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGAGTGAGCACCTCGCTGTACAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.341 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTGGGCTGAGTGAGCACCTCGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.349 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGCAGTGATGAGCTGTTGCTGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.358 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGAAGACCAGCAGCTCCTGGACAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.558 | 0.200 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCTGCTTGGGATGAGACCAATCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.576 | 0.017 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATAGGCTGAAGACCAGCAGCTCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.586 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATCTATAGGCTGACTTCATTCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.596 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATAGGCTGACTTCATTCTCATAGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.606 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGCAAGCAGCAGTGATGAGCTGTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.729 | 0.123 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGGTCCCCAGCACAGTGACATTCA)%26(nt:TGAGTTCTAGACACCGAGGCCTGGG)%26(nt:TGAGACCAATCTATAGGCTGACTTC)%26(nt:TAGCTTACCTGTGTACTCCTTGTAA)%26(nt:TACCGTGTACGCACTAAAGGATGAA)%26(nt:GTGACTGACCAGAGTCCTCGGCTTT)%26(nt:GTACTCCTTGTAAATACTGAGATCT)%26(nt:GCTGAGTGAGCACCTCGCTGTACAC)%26(nt:GCCTGGGCTGAGTGAGCACCTCGCT)%26(nt:GCAGCAGTGATGAGCTGTTGCTGAA)%26(nt:CTGAAGACCAGCAGCTCCTGGACAA)%26(nt:CCCTGCTTGGGATGAGACCAATCTA)%26(nt:CATAGGCTGAAGACCAGCAGCTCCT)%26(nt:CAATCTATAGGCTGACTTCATTCTC)%26(nt:ATAGGCTGACTTCATTCTCATAGGC)%26(nt:AGGCAAGCAGCAGTGATGAGCTGTT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.736 | 0.007 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]