GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:41:36, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant 2, mRNA. (4379 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctcaccaaaaaaaaaaaaaaaaaa
position 4257 4258 4260 4263 4275 4279 4282 4284 4285 4287 4288 4290 4291 4293 4299 4300
Synonym: P85spr; Pak3bp
NM_001113522.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant 1, mRNA. (4556 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctcaccaaaaaaaaaaaaaaaaaa
position 4434 4435 4437 4440 4452 4456 4459 4461 4462 4464 4465 4467 4468 4470 4476 4477
Synonym: P85spr; Pak3bp
NM_001113521.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X6, mRNA. (4506 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 4404 4405 4407 4410 4422 4426 4429 4431 4432 4434 4435 4437 4438 4440 4446 4447
Synonym: P85spr; Pak3bp
XM_008771380.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X4, mRNA. (4593 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 4491 4492 4494 4497 4509 4513 4516 4518 4519 4521 4522 4524 4525 4527 4533 4534
Synonym: P85spr; Pak3bp
XM_008771379.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X5, mRNA. (4629 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 4527 4528 4530 4533 4545 4549 4552 4554 4555 4557 4558 4560 4561 4563 4569 4570
Synonym: P85spr; Pak3bp
XM_017599975.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X3, mRNA. (15282 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 15180 15181 15183 15186 15198 15202 15205 15207 15208 15210 15211 15213 15214 15216 15222 15223
Synonym: P85spr; Pak3bp
XM_008771378.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X2, mRNA. (15329 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 15227 15228 15230 15233 15245 15249 15252 15254 15255 15257 15258 15260 15261 15263 15269 15270
Synonym: P85spr; Pak3bp
XM_008771377.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus Rho guanine nucleotide exchange factor 7 (Arhgef7), transcript variant X1, mRNA. (15507 bp)
tgcacccggagcagtcctttttaaagctggcacacaccccgttctcctcctgcatctctgcggtggagctctgacacccacagcacagggtgcctctcaccaactccaactcctccgcgctctgtgagggatgagggggattaagccatttcctgtcctctagtgaagcactttccgttctgaaccatgctgctgcgtgcagcctctgaagctccactcttccctcccagttgttgcccacgctccctgtgcacctcatgccaacccctccttccctgcgacactgcaggagccggtgctggcagaccgcaccggtgtgactgctgcagtgtgtgtgctgccccctccaattattaaactccttattttcctatctca
position 15405 15406 15408 15411 15423 15427 15430 15432 15433 15435 15436 15438 15439 15441 15447 15448
Synonym: P85spr; Pak3bp
XM_008771376.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA859562_at
lang : en | div : | spe : rn | query_string : rc_AA859562_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCGACACTGCAGGAGCCGGTGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.095 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGACTGCTGCAGTGTGTGTGCTGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.105 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCAGACCGCACCGGTGTGACTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.115 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGGCAGACCGCACCGGTGTGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.125 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCACCGGTGTGACTGCTGCAGTGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.134 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTGCTGCAGTGTGTGTGCTGCCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.147 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCGACACTGCAGGAGCCGGTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.157 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGTGCTGGCAGACCGCACCGGTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.168 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGACACTGCAGGAGCCGGTGCTGGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.178 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGGTGTGACTGCTGCAGTGTGTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.189 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGCACCGGTGTGACTGCTGCAGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.198 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGACCGCACCGGTGTGACTGCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.209 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACTGCAGGAGCCGGTGCTGGCAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.218 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACCGGTGTGACTGCTGCAGTGTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.228 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGACCGCACCGGTGTGACTGCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.239 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCGCACCGGTGTGACTGCTGCAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.320 | 0.081 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCGACACTGCAGGAGCCGGTGCTG)%26(nt:TGACTGCTGCAGTGTGTGTGCTGCC)%26(nt:GGCAGACCGCACCGGTGTGACTGCT)%26(nt:GCTGGCAGACCGCACCGGTGTGACT)%26(nt:GCACCGGTGTGACTGCTGCAGTGTG)%26(nt:GACTGCTGCAGTGTGTGTGCTGCCC)%26(nt:CTGCGACACTGCAGGAGCCGGTGCT)%26(nt:CGGTGCTGGCAGACCGCACCGGTGT)%26(nt:CGACACTGCAGGAGCCGGTGCTGGC)%26(nt:CCGGTGTGACTGCTGCAGTGTGTGT)%26(nt:CCGCACCGGTGTGACTGCTGCAGTG)%26(nt:CAGACCGCACCGGTGTGACTGCTGC)%26(nt:CACTGCAGGAGCCGGTGCTGGCAGA)%26(nt:CACCGGTGTGACTGCTGCAGTGTGT)%26(nt:AGACCGCACCGGTGTGACTGCTGCA)%26(nt:ACCGCACCGGTGTGACTGCTGCAGT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.327 | 0.007 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]