GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-06-15 19:39:59, GGRNA : RefSeq release 206 (May, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus secreted phosphoprotein 2 (Spp2), mRNA. (947 bp)
gacagtcaccctcggaaagagctgtagagaggccatctccttggctctgggtcgccgtcctcgggatggagctggcaacgatgaagacgctggttatgttggtgctgggaatgcactactggtgtgcctcaggtttcccggtgtacgactacgacccttcctctctgcaagaagctctcagtgcctcagtggctaaggtgaactcgcaatccctgagtccttacctgtttcgggcgacgcggagctccctgaagagagttaatgtcctggatgaagacacactggtcatgaacttagagttcaccgttcaggaaactacatgcctaagagagtctggtgatccctccacctgcgccttccaaaggggctactctgtgccaacagctgcttgcaggagcacagtgcagatgtccaagggacaggtgaaggatgtgtgggctcactgccgctgggcgtccacatccgagtccaacagcagtgaggagatgatttttggggacatggcaagatcccaccgacgaagaaatgattatctacttggctttctttatgatgaacccaaaggtgagcagttctatgaccggtcgattgagatcacga...
position 312 316 325 329 341 347 358 362 366 386 390 394 398 402 406 435
NM_053577.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus secreted phosphoprotein 2 (Spp2), transcript variant X1, mRNA. (1169 bp)
gacagtcaccctcggaaagagctgtagagaggccatctccttggctctgggtcgccgtcctcgggatggagctggcaacgatgaagacgctggttatgttggtgctgggaatgcactactggtgtgcctcaggtttcccggtgtacgactacgacccttcctctctgcaagaagctctcagtgcctcagtggctaaggtgaactcgcaatccctgagtccttacctgtttcgggcgacgcggagctccctgaagagagttaatgtcctggatgaagacacactggtcatgaacttagagttcaccgttcaggaaactacatgcctaagagagtctggtgatccctccacctgcgccttccaaaggggctactctgtgccaacagctgcttgcaggagcacagtgcagatgtccaagggacaggtgaaggatgtgtgggctcactgccgctgggcgtccacatccgagtccaacagcagtgaggagatgatttttggggacatggcaagatcccaccgacgaagaaatgattatctacttggctttctttatgatgaacccaaagagatcacgaggaggggacatcctcctgcccatagaa...
position 629 633 642 646 658 664 675 679 683 703 707 711 715 719 723 752
XM_039084306.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA858573_s_at
lang : en | div : | spe : rn | query_string : rc_AA858573_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCCTAAGAGAGTCTGGTGATCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCACCGTTCAGGAAACTACATGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.110 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TACATGCCTAAGAGAGTCTGGTGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.119 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GTTTCGGGCGACGCGGAGCTCCCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GCTCCCTGAAGAGAGTTAATGTCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.144 | 0.013 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAGTTAATGTCCTGGATGAAGACAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.154 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:GAAGACACACTGGTCATGAACTTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.163 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTGCGCCTTCCAAAGGGGCTACTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.173 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGTTCAGGAAACTACATGCCTAAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.184 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGGGCGACGCGGAGCTCCCTGAAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.195 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGGAGCTCCCTGAAGAGAGTTAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.205 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CAGGAAACTACATGCCTAAGAGAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.498 | 0.292 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATGTCCTGGATGAAGACACACTGGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.776 | 0.278 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACTGGTCATGAACTTAGAGTTCACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.786 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ACACACTGGTCATGAACTTAGAGTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.795 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAACTACATGCCTAAGAGAGTCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.817 | 0.022 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGCCTAAGAGAGTCTGGTGATCCCT)%26(nt:TCACCGTTCAGGAAACTACATGCCT)%26(nt:TACATGCCTAAGAGAGTCTGGTGAT)%26(nt:GTTTCGGGCGACGCGGAGCTCCCTG)%26(nt:GCTCCCTGAAGAGAGTTAATGTCCT)%26(nt:GAGTTAATGTCCTGGATGAAGACAC)%26(nt:GAAGACACACTGGTCATGAACTTAG)%26(nt:CTGCGCCTTCCAAAGGGGCTACTCT)%26(nt:CGTTCAGGAAACTACATGCCTAAGA)%26(nt:CGGGCGACGCGGAGCTCCCTGAAGA)%26(nt:CGGAGCTCCCTGAAGAGAGTTAATG)%26(nt:CAGGAAACTACATGCCTAAGAGAGT)%26(nt:ATGTCCTGGATGAAGACACACTGGT)%26(nt:ACTGGTCATGAACTTAGAGTTCACC)%26(nt:ACACACTGGTCATGAACTTAGAGTT)%26(nt:AAACTACATGCCTAAGAGAGTCTGG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.819 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]