GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-06-15 19:32:01, GGRNA : RefSeq release 206 (May, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus TATA-box binding protein associated factor 10 (Taf10), transcript variant X1, mRNA. (781 bp)
ctagcacggccgcggagagcaaagccagccccgcggggacagcagggggccctggagctggagtcgccactgcaggcacgggccccgtggcggcacgggcaggggagcccgcggagcggcgcggaccggcttcggtggcagcaggcggcgcggctccccctgagggggcaatgtctaacggggtttacgccctaccgagcgcggccaacggagaagtgaagcccgtagtgtccagcacaccactagtggacttcttgatgcagttggaggattatacacctacgatcccggatgcagtgactggttactacctgaaccgtgctggctttgaagcttcagacccacgcataattcggctcatctcactagctgcccagaaattcatctcagatattgccaatgatgccctacagcactgcaaaatgaagggtacagcctctggcagctcccggagcaagagcaaggtgtgagaggatcgcaagtacaccctaaccatggaggacttgacccctgccctcagcgagtatggcatcaatgtgaagaagccgcactacttcacctgagccacccaacccagatgtatttgtcttcccctctgtc...
position 360 366 372 384 396 414 426 444 474 480 486 492 504 510 516 522
XM_039106805.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus TATA-box binding protein associated factor 10 (Taf10), mRNA. (869 bp)
ctagcacggccgcggagagcaaagccagccccgcggggacagcagggggccctggagctggagtcgccactgcaggcacgggccccgtggcggcacgggcaggggagcccgcggagcggcgcggaccggcttcggtggcagcaggcggcgcggctccccctgagggggcaatgtctaacggggtttacgccctaccgagcgcggccaacggagaagtgaagcccgtagtgtccagcacaccactagtggacttcttgatgcagttggaggattatacacctacgatcccggatgcagtgactggttactacctgaaccgtgctggctttgaagcttcagacccacgcataattcggctcatctcactagctgcccagaaattcatctcagatattgccaatgatgccctacagcactgcaaaatgaagggtacagcctctggcagctcccggagcaagagcaaggatcgcaagtacaccctaaccatggaggacttgacccctgccctcagcgagtatggcatcaatgtgaagaagccgcactacttcacctgagccacccaacccagatgtatttgtcttcccctctgtccccacatga...
position 335 341 347 359 371 389 401 419 449 455 461 467 479 485 491 497
NM_001134735.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/rc_AA800015_at
lang : en | div : | spe : rn | query_string : rc_AA800015_at | format : html | download :

0.000 | 0.000 | search_start;
0.090 | 0.090 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTCCAGCACACCACTAGTGGACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.101 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGAAGCCCGTAGTGTCCAGCACACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.109 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCTTGATGCAGTTGGAGGATTATAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.118 | 0.008 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TCTCACTAGCTGCCCAGAAATTCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.130 | 0.012 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAGCTGCCCAGAAATTCATCTCAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.433 | 0.302 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TAATTCGGCTCATCTCACTAGCTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.442 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CTGGTTACTACCTGAACCGTGCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.452 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CGATCCCGGATGCAGTGACTGGTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.462 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCGTAGTGTCCAGCACACCACTAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.471 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CCCAGAAATTCATCTCAGATATTGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.480 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CAGACCCACGCATAATTCGGCTCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.489 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CACTAGTGGACTTCTTGATGCAGTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.500 | 0.011 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:CACGCATAATTCGGCTCATCTCACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.510 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:ATTATACACCTACGATCCCGGATGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.519 | 0.010 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AATTCATCTCAGATATTGCCAATGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.529 | 0.009 | count_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:AAGCTTCAGACCCACGCATAATTCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.561 | 0.032 | search_done; http://172.18.8.71:7700/v1/refsub/query?q=(nt:TGTCCAGCACACCACTAGTGGACTT)%26(nt:TGAAGCCCGTAGTGTCCAGCACACC)%26(nt:TCTTGATGCAGTTGGAGGATTATAC)%26(nt:TCTCACTAGCTGCCCAGAAATTCAT)%26(nt:TAGCTGCCCAGAAATTCATCTCAGA)%26(nt:TAATTCGGCTCATCTCACTAGCTGC)%26(nt:CTGGTTACTACCTGAACCGTGCTGG)%26(nt:CGATCCCGGATGCAGTGACTGGTTA)%26(nt:CCGTAGTGTCCAGCACACCACTAGT)%26(nt:CCCAGAAATTCATCTCAGATATTGC)%26(nt:CAGACCCACGCATAATTCGGCTCAT)%26(nt:CACTAGTGGACTTCTTGATGCAGTT)%26(nt:CACGCATAATTCGGCTCATCTCACT)%26(nt:ATTATACACCTACGATCCCGGATGC)%26(nt:AATTCATCTCAGATATTGCCAATGA)%26(nt:AAGCTTCAGACCCACGCATAATTCG)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.563 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]