2024-05-21 03:48:24, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_138837 3127 bp mRNA linear ROD 22-NOV-2023 DEFINITION Rattus norvegicus POU class 3 homeobox 3 (Pou3f3), mRNA. ACCESSION NM_138837 VERSION NM_138837.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 3127) AUTHORS Snijders Blok L, Kleefstra T, Venselaar H, Maas S, Kroes HY, Lachmeijer AMA, van Gassen KLI, Firth HV, Tomkins S, Bodek S, Ounap K, Wojcik MH, Cunniff C, Bergstrom K, Powis Z, Tang S, Shinde DN, Au C, Iglesias AD, Izumi K, Leonard J, Abou Tayoun A, Baker SW, Tartaglia M, Niceta M, Dentici ML, Okamoto N, Miyake N, Matsumoto N, Vitobello A, Faivre L, Philippe C, Gilissen C, Wiel L, Pfundt R, Deriziotis P, Brunner HG and Fisher SE. CONSRTM DDD Study TITLE De Novo Variants Disturbing the Transactivation Capacity of POU3F3 Cause a Characteristic Neurodevelopmental Disorder JOURNAL Am J Hum Genet 105 (2), 403-412 (2019) PUBMED 31303265 REFERENCE 2 (bases 1 to 3127) AUTHORS Mutai H, Nagashima R, Sugitani Y, Noda T, Fujii M and Matsunaga T. TITLE Expression of Pou3f3/Brn-1 and its genomic methylation in developing auditory epithelium JOURNAL Dev Neurobiol 69 (14), 913-930 (2009) PUBMED 19743445 REMARK GeneRIF: Pou3f3 may be important for the maintenance or functional development of the postnatal cochlea. This is the first report to study involvement of an epigenetic regulatory mechanism in the developing mammalian auditory epithelium. REFERENCE 3 (bases 1 to 3127) AUTHORS Kim DK, Han SB, Hong ST, Choi YJ, Sun W, Geum D and Kim H. TITLE Expression of Sox11 and Brn transcription factors during development and following transient forebrain ischemia in the rat JOURNAL Neurosci Lett 433 (3), 259-264 (2008) PUBMED 18261853 REMARK GeneRIF: Collectively, overall results suggest that the expression of Sox11 and Brn1 may be modulated by the cell-type specific machinery. REFERENCE 4 (bases 1 to 3127) AUTHORS Aigner B, Rathkolb B, Herbach N, Kemter E, Schessl C, Klaften M, Klempt M, de Angelis MH, Wanke R and Wolf E. TITLE Screening for increased plasma urea levels in a large-scale ENU mouse mutagenesis project reveals kidney disease models JOURNAL Am J Physiol Renal Physiol 292 (5), F1560-F1567 (2007) PUBMED 17264314 REFERENCE 5 (bases 1 to 3127) AUTHORS Castro DS, Skowronska-Krawczyk D, Armant O, Donaldson IJ, Parras C, Hunt C, Critchley JA, Nguyen L, Gossler A, Gottgens B, Matter JM and Guillemot F. TITLE Proneural bHLH and Brn proteins coregulate a neurogenic program through cooperative binding to a conserved DNA motif JOURNAL Dev Cell 11 (6), 831-844 (2006) PUBMED 17141158 REFERENCE 6 (bases 1 to 3127) AUTHORS Kuhlbrodt K, Herbarth B, Sock E, Enderich J, Hermans-Borgmeyer I and Wegner M. TITLE Cooperative function of POU proteins and SOX proteins in glial cells JOURNAL J Biol Chem 273 (26), 16050-16057 (1998) PUBMED 9632656 REFERENCE 7 (bases 1 to 3127) AUTHORS Schreiber J, Enderich J, Sock E, Schmidt C, Richter-Landsberg C and Wegner M. TITLE Redundancy of class III POU proteins in the oligodendrocyte lineage JOURNAL J Biol Chem 272 (51), 32286-32293 (1997) PUBMED 9405434 REFERENCE 8 (bases 1 to 3127) AUTHORS Malik KF, Jaffe H, Brady J and Young WS 3rd. TITLE The class III POU factor Brn-4 interacts with other class III POU factors and the heterogeneous nuclear ribonucleoprotein U JOURNAL Brain Res Mol Brain Res 45 (1), 99-107 (1997) PUBMED 9105675 REFERENCE 9 (bases 1 to 3127) AUTHORS Sock E, Enderich J, Rosenfeld MG and Wegner M. TITLE Identification of the nuclear localization signal of the POU domain protein Tst-1/Oct6 JOURNAL J Biol Chem 271 (29), 17512-17518 (1996) PUBMED 8663425 REFERENCE 10 (bases 1 to 3127) AUTHORS Le Moine C and Young WS 3rd. TITLE RHS2, a POU domain-containing gene, and its expression in developing and adult rat JOURNAL Proc Natl Acad Sci U S A 89 (8), 3285-3289 (1992) PUBMED 1348858 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000214.1. On Mar 18, 2021 this sequence version replaced NM_138837.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-3127 JACYVU010000214.1 940763-943889 FEATURES Location/Qualifiers source 1..3127 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="9" /map="9q22" gene 1..3127 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="POU class 3 homeobox 3" /db_xref="GeneID:192109" /db_xref="RGD:619768" exon 1..3127 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /inference="alignment:Splign:2.1.0" CDS 67..1560 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /function="transcription factor" /note="class III POU protein POU-domain; brain-1; brn-1 protein; brain-specific homeobox/POU domain protein 1" /codon_start=1 /product="POU domain, class 3, transcription factor 3" /protein_id="NP_620192.2" /db_xref="GeneID:192109" /db_xref="RGD:619768" /translation="
MATAASNPYLPGNSLLAAGSIVHSDAAGAGGGGGGGGGGGGGAGGGGGGMQPGSAAVTSGAYRGDPSSVKMVQSDFMQGAMAASNGGHMLSHAHQWVTALPHAAAAAAAAAAAAVEASSPWSGSAVGMAGSPQQPPQPPPPPPQGPDVKGGAGREDLHAGTALHHRGPPHLGPPPPPPHQGHPGGWGAAAAAAAAAAAAAAAAHLPSMAGGQQPPPQSLLYSQPGGFTVNGMLSAPPGPGGGGGGAGGGAQSLVHPGLVRGDTPELAEHHHHHHHHAHPHPPHPHHAQGPPHHGGGGAGPGLNSHDPHSDEDTPTSDDLEQFAKQFKQRRIKLGFTQADVGLALGTLYGNVFSQTTICRFEALQLSFKNMCKLKPLLNKWLEEADSSTGSPTSIDKIAAQGRKRKKRTSIEVSVKGALESHFLKCPKPSAQEITNLADSLQLEKEVVRVWFCNRRQKEKRMTPPGIQQQTPDDVYSQVGTVSADTPPPHHGLQTSVQ"
misc_feature 157..252 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="propagated from UniProtKB/Swiss-Prot (Q63262.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 427..633 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="propagated from UniProtKB/Swiss-Prot (Q63262.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 754..1014 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="propagated from UniProtKB/Swiss-Prot (Q63262.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" misc_feature 997..1221 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="Found in Pit-Oct-Unc transcription factors; Region: POU; smart00352" /db_xref="CDD:197673" misc_feature order(1276..1290,1294..1296,1345..1347,1363..1365, 1402..1404,1408..1413,1420..1425,1429..1437,1441..1446) /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 1282..1443 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(1282..1284,1291..1293,1411..1413,1420..1425, 1432..1434) /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" misc_feature 1438..1557 /gene="Pou3f3" /gene_synonym="Brn1; RHS1" /note="propagated from UniProtKB/Swiss-Prot (Q63262.2); Region: Disordered. /evidence=ECO:0000256|SAM:MobiDB-lite" ORIGIN
gcggccgcggctgctgctgcggcggcggcggtggtggcggcggtggggtggcgggagcggagcggcatggccacggcggcttctaacccctacctgccggggaacagcctgctcgcggccggatccattgtgcactcggacgcggccggggcgggcggcggcggagggggcggcggcggtggcggcggcggggcggggggcggcggcggcggcatgcagccgggaagcgccgccgtgacctcgggcgcctaccggggggatccgtcctccgtcaagatggtccagagtgacttcatgcagggggccatggccgccagcaacggcggccatatgctgagccacgcgcaccagtgggtcaccgccctgccccacgctgccgccgctgccgccgctgctgccgccgccgccgtggaagccagctctccgtggtcgggcagcgcggtgggcatggccggcagcccccagcagccaccacagccgccgccgccgccgccgcagggccccgacgtgaagggaggcgctggacgcgaagacctgcacgccggcacagcgctgcaccaccgcggaccgccgcacctcgggcccccgccaccgccccctcaccagggacaccctggaggctggggggccgcagccgccgctgccgctgccgccgccgccgccgctgccgccgctcacctcccgtccatggcgggcggccagcagccgccgccgcagagtctgctgtactcgcagcccggaggcttcacggtgaacggcatgctgagcgcgcccccggggccaggcggtggcggcggcggagcgggcggtggagcccaaagcctggttcacccggggttagtgcgcggggacacgcccgagctggcggagcatcatcaccaccatcaccaccacgcgcacccgcacccgccgcacccgcaccacgcgcagggacccccacatcacggtggcggcggagcggggccaggactcaacagccacgacccgcactcggacgaggacacgccgacgtctgacgacctggagcagttcgctaagcagttcaagcagcggcgcatcaagctgggcttcacccaggcggacgtggggctggctctgggcactctgtatggcaatgtgttctcgcagaccaccatctgccgcttcgaggccctgcagctcagtttcaagaacatgtgcaagctcaagccgctgctgaacaagtggctggaggaggccgactcgagcaccggcagccccaccagcattgacaagatcgcagcacagggccgcaagcgcaagaagcggacctccatcgaggttagcgtcaaaggcgcgctggagagccacttcctcaagtgccctaaaccctcggcgcaggagatcaccaacttggccgacagcctgcagctggaaaaggaggtcgtgcgggtctggttctgcaaccgacgccaaaaggaaaaacgcatgacgccccctggcatccagcagcagacgccggacgatgtctactcgcaggtggggaccgtgagcgctgacacaccgccaccgcaccacgggctgcagaccagcgtgcagtgaatgccggggcgcagcgcgaagtgggccgccgccaccacctccgcagccgctgtcagcaccgccacggtcaccgccgctgccgtctctgagcggccgccgagaaccaccgccgccgctgctgccgctgctgccgccgccgccgccgccgccgccgccgccgctgccgccgcgcagacccaacacctggccagtgccagggtgaccaggcctcctcccctccgcccaaagacaggcgagccatggccctaggaggggggagaacagctggagaccgatgagactctttctgaagtccaaggaaggagggaccaaaaacaaatttttaagcataataaataccaagactgttttatatgcatatataacaaacaaaaccggaagaggaaaagggaggaacaaggacatctcgtttatactgtggtggtgttttgttcctgttttgaaagaagggtgaagatgcctaacgcaccaaaactacacacgaggtactgtccacaccgagatgtcctgctcggcgacagtggagaacacctgcctctgagataagagagaccccctccccgttcttccacttcttccaaaagggctgcctaaaagatccatggaaactttctttactgggagcgacctgaaaagaaagacgcaccaggtttcctgcaggtctgactctgctcctcgacagtgtttttcttggccatattcaagtctttggggaacaaataaatcaactaagaaatgggaaggaaggagaaacagagtctggggggggagggaagattcacagcttctgaagttaacagactgaacaggaaagccaaaagaaagcatccttgccgtaaacttgggaataaaagcatcgcgaaagagccaaggctgggcgaggctgaagggtaggtatgtccagccgcaatccgccagcggagagggcacaacagcggggccagggcccagcctttgagaccgcccagaagggccaggtctcccccacgccactgaacccgggctttgccgactgccgctcggggtggaccatgcctaaagattccgccgctaatattttttttattaacattttttattttttatttctggactgactccgataaaagggtgtggaaagacagcaccaaccgcgcacttcccttgacttctgccctcgatccgttgccaactttgattgaatgggtgctgcggatgtgattatgtaatactgccatttccaagcagtgtttttggtaggttttaataaacagacttttcaaatgacggcaatatagaatcgttagatccgttgttgatctaaaaatatttgctttatattttcattaaatgacttcttttaatattttattcaaaatacttatgaactgctgcaaaacggtaatttatttttccccagatcttgtattacgtgtttttttcagacgagcacaaatcaaaatgaaatgaaaatatggacagttgttaggtaataagggtatcttttgatgtgatcatttgattgtaatttaatttgagtagtgattccgtaagagctgattgagaaaataaatttgttagaatgaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]