2024-05-19 18:34:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_012730 1674 bp mRNA linear ROD 21-MAR-2023 DEFINITION Rattus norvegicus cytochrome P450, family 2, subfamily d, polypeptide 2 (Cyp2d2), mRNA. ACCESSION NM_012730 VERSION NM_012730.2 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1674) AUTHORS Iwaki M, Niwa T, Nakamura Y, Kawase A and Komura H. TITLE Relative contribution of rat CYP isoforms responsible for stereoselective metabolism of carvedilol JOURNAL J Toxicol Sci 43 (1), 59-63 (2018) PUBMED 29415952 REMARK GeneRIF: It shows the highest metabolic activities against enantiomers of carvedilol. REFERENCE 2 (bases 1 to 1674) AUTHORS Liu R, Qin M, Hang P, Liu Y, Zhang Z and Liu G. TITLE Effects of Panax notoginseng saponins on the activities of CYP1A2, CYP2C9, CYP2D6 and CYP3A4 in rats in vivo JOURNAL Phytother Res 26 (8), 1113-1118 (2012) PUBMED 22162298 REMARK GeneRIF: Panax notoginseng saponins had no significant effects on the activities of CYP2C9, CYP2D6, and CYP3A4, but it could induce the activity of CYP1A2 in rats in vivo. REFERENCE 3 (bases 1 to 1674) AUTHORS Grondin M, Hamel F, Sarhan F and Averill-Bates DA. TITLE Metabolic activity of cytochrome p450 isoforms in hepatocytes cryopreserved with wheat protein extract JOURNAL Drug Metab Dispos 36 (10), 2121-2129 (2008) PUBMED 18617602 REFERENCE 4 (bases 1 to 1674) AUTHORS Dickmann LJ, Tay S, Senn TD, Zhang H, Visone A, Unadkat JD, Hebert MF and Isoherranen N. TITLE Changes in maternal liver Cyp2c and Cyp2d expression and activity during rat pregnancy JOURNAL Biochem Pharmacol 75 (8), 1677-1687 (2008) PUBMED 18342837 REFERENCE 5 (bases 1 to 1674) AUTHORS Narimatsu S, Kiryu K, Yonemoto R, Yoshino M, Kobatake M, Kazamori D, Hagino S, Masuda K, Katsu T, Asanuma M, Kumamoto T, Ishikawa T, Funae Y, Yamano S, Hanioka N and Naito S. TITLE The roles of amino acid residues at positions 216 and 219 in the structural stability and metabolic functions of rat cytochrome P450 2D1 and 2D2 JOURNAL Chem Biol Interact 172 (1), 11-21 (2008) PUBMED 18191824 REMARK GeneRIF: The effects of the mutual substitution of amino acid residues at positions 216 and 219 between rat CYP2D1 and CYP2D2 on their microsomal contents and enzymatic functions are reported. REFERENCE 6 (bases 1 to 1674) AUTHORS Wan J, Imaoka S, Chow T, Hiroi T, Yabusaki Y and Funae Y. TITLE Expression of four rat CYP2D isoforms in Saccharomyces cerevisiae and their catalytic specificity JOURNAL Arch Biochem Biophys 348 (2), 383-390 (1997) PUBMED 9434752 REFERENCE 7 (bases 1 to 1674) AUTHORS Matsunaga E, Umeno M and Gonzalez FJ. TITLE The rat P450 IID subfamily: complete sequences of four closely linked genes and evidence that gene conversions maintained sequence homogeneity at the heme-binding region of the cytochrome P450 active site JOURNAL J Mol Evol 30 (2), 155-169 (1990) PUBMED 2107330 REFERENCE 8 (bases 1 to 1674) AUTHORS Matsunaga E, Zanger UM, Hardwick JP, Gelboin HV, Meyer UA and Gonzalez FJ. TITLE The CYP2D gene subfamily: analysis of the molecular basis of the debrisoquine 4-hydroxylase deficiency in DA rats JOURNAL Biochemistry 28 (18), 7349-7355 (1989) PUBMED 2819073 REFERENCE 9 (bases 1 to 1674) AUTHORS Ishida N, Tawaragi Y, Inuzuka C, Sugita O, Kubota I, Nakazato H, Noguchi T and Sassa S. TITLE Four species of cDNAs for cytochrome P450 isozymes immunorelated to P450C-M/F encode for members of P450IID subfamily, increasing the number of members within the subfamily JOURNAL Biochem Biophys Res Commun 156 (2), 681-688 (1988) PUBMED 3190674 REFERENCE 10 (bases 1 to 1674) AUTHORS Gonzalez,F.J., Matsunaga,T., Nagata,K., Meyer,U.A., Nebert,D.W., Pastewka,J., Kozak,C.A., Gillette,J., Gelboin,H.V. and Hardwick,J.P. TITLE Debrisoquine 4-hydroxylase: characterization of a new P450 gene subfamily, regulation, chromosomal mapping, and molecular analysis of the DA rat polymorphism JOURNAL DNA 6 (2), 149-161 (1987) PUBMED 3582092 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000187.1. On Nov 20, 2020 this sequence version replaced NM_012730.1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: M22330.1, AB008423.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMEA5756307, SAMEA5760400 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-289 JACYVU010000187.1 673420-673708 c 290-461 JACYVU010000187.1 672627-672798 c 462-614 JACYVU010000187.1 672240-672392 c 615-775 JACYVU010000187.1 672006-672166 c 776-952 JACYVU010000187.1 671154-671330 c 953-1094 JACYVU010000187.1 670834-670975 c 1095-1282 JACYVU010000187.1 670459-670646 c 1283-1424 JACYVU010000187.1 669987-670128 c 1425-1674 JACYVU010000187.1 669637-669886 c FEATURES Location/Qualifiers source 1..1674 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="7" /map="7q34" gene 1..1674 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="cytochrome P450, family 2, subfamily d, polypeptide 2" /db_xref="GeneID:25053" /db_xref="RGD:2471" exon 1..289 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" misc_feature 50..52 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="upstream in-frame stop codon" CDS 101..1603 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /EC_number="1.14.14.1" /note="debrisoquine 4-hydroxylase; cytochrome P450-DB2; cytochrome P450-CMF2; cytochrome P450, family 2, subfamily d, polypeptide 26; Cytochrome P450, subfamily IID2" /codon_start=1 /product="cytochrome P450 2D26" /protein_id="NP_036862.2" /db_xref="GeneID:25053" /db_xref="RGD:2471" /translation="
MGLLIGDDLWAVVIFTAIFLLLVDLVHRHKFWTAHYPPGPVPLPGLGNLLQVDFENMPYSLYKLRSRYGDVFSLQIAWKPVVVINGLKAVRELLVTYGEDTADRPLLPIYNHLGYGNKSKGVVLAPYGPEWREQRRFSVSTLRDFGVGKKSLEQWVTEEAGHLCDTFAKEAEHPFNPSILLSKAVSNVIASLVYARRFEYEDPFFNRMLKTLKESFGEDTGFMAEVLNAIPILLQIPGLPGKVFPKLNSFIALVDKMLIEHKKSWDPAQPPRDMTDAFLAEMQKAKGNPESSFNDENLRLVVIDLFMAGMVTTSTTLSWALLLMILHPDVQRRVHEEIDEVIGQVRRPEMADQARMPFTNAVIHEVQRFADIVPTNIPHMTSRDIKFQGFLIPKGTTLIPNLSSVLKDETVWEKPLRFHPEHFLDAQGNFVKHEAFMPFSAGRRACLGEPLARMELFLFFTCLLQRFSFSVLAGRPRPSTHGVYALPVTPQPYQLCAVAR"
misc_feature 302..1585 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="cytochrome P450 family 2, subfamily D; Region: CYP2D; cd20663" /db_xref="CDD:410756" misc_feature order(410..412,464..469,491..493,503..505,1013..1015, 1022..1027,1034..1039,1046..1048,1199..1201,1229..1231, 1235..1237,1304..1306,1412..1420,1430..1432,1436..1444, 1451..1453) /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="heme binding site [chemical binding]; other site" /db_xref="CDD:410756" misc_feature order(437..439,467..469,743..748,755..757,839..841, 848..853,1007..1012,1019..1024,1034..1036,1556..1558) /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="chemical substrate binding pocket [chemical binding]; other site" /db_xref="CDD:410756" misc_feature 845..847 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /note="Phosphoserine. /evidence=ECO:0007744|PubMed:22673903; propagated from UniProtKB/Swiss-Prot (P10634.2); phosphorylation site" exon 290..461 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 462..614 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 615..775 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 776..952 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 953..1094 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 1095..1282 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 1283..1424 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" exon 1425..1674 /gene="Cyp2d2" /gene_synonym="Cyp2d26; CYPIID26; P450-CMF2; P450-DB2" /inference="alignment:Splign:2.1.0" ORIGIN
tttaagggaccaggttcccagtctgttgtaagaggatctttcctgattctaagtgtctggacaagtattccttcaaaagcctgcaagccgtggggcagccatggggctgctgattggagatgacctctgggctgtggtcatattcacagccatcttcttgcttctggtggacctggtgcaccggcacaaattctggactgcccactaccctcccggccctgtgccactccctgggctgggaaacctgctgcaggtggactttgagaacatgccatatagcttatacaagcttcgaagccgctatggtgacgtgttcagcctacagatagcctggaagcctgtagttgtgatcaacgggctgaaggccgtgcgggaactgctggtgacctatggagaggacactgctgaccgccccctactgcccatctataatcacctgggctatgggaacaaatcaaaaggtgtggtccttgcaccttacggacctgagtggcgagagcagagacgattctctgtgtccaccctgcgtgacttcggcgtgggcaagaaatcgctggagcagtgggtgacagaggaggccggccacctctgtgacaccttcgccaaggaggctgaacatcccttcaatcccagcatcctcctgagtaaggctgtgagcaacgtgattgcctcccttgtttatgctcgtcgatttgagtatgaggaccctttcttcaacaggatgctcaaaacattgaaggagagctttggagaggacaccggcttcatggcagaggtgctgaacgcaatcccaattctccttcagattcctgggctgcctggcaaagtcttccccaagctcaattcatttatagccttagtggataagatgttaattgagcacaagaaaagctgggatcctgcccagccgccccgagacatgactgatgccttcctagcagagatgcaaaaggccaaggggaatcctgagagcagcttcaatgatgaaaatctgcgcttggtggtgattgacctgttcatggcggggatggtgaccacctcaaccacactgtcctgggcccttctgctcatgatcctgcatccagatgtgcagcgccgagtccacgaggagattgatgaggtcatagggcaggtgcgtcgtccagagatggcagaccaggcacgaatgccgttcaccaatgctgtcatccatgaggtgcagcgctttgcagacatcgtcccgacaaatataccacatatgacatcccgagacattaaattccaaggcttcctcatccccaaggggacaaccctcatccccaacctgtcctccgtgctgaaggatgagaccgtctgggagaagcccctccgcttccatccagaacacttcctggatgcccagggcaactttgtgaagcatgaggccttcatgccattctcagcaggccgcagagcatgcctgggggagcccctggcccgcatggagctcttcctcttcttcacctgcctcctgcagcgcttcagcttctcggtgctggccggccggccccggcccagcacccatggcgtctacgcattgccagttactccacagccttaccaactctgtgcagtggctcgctagcaggggcaggggctccattcttctccccggtttggtctgattgatgtccaataaacaacttctgtatcttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]