2024-05-21 02:46:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NM_001271453 1831 bp mRNA linear ROD 20-MAR-2023 DEFINITION Rattus norvegicus gastrulation brain homeobox 1 (Gbx1), mRNA. ACCESSION NM_001271453 XM_001063850 VERSION NM_001271453.1 KEYWORDS RefSeq; RefSeq Select. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 1831) AUTHORS Meziane H, Fraulob V, Riet F, Krezel W, Selloum M, Geffarth M, Acampora D, Herault Y, Simeone A, Brand M, Dolle P and Rhinn M. TITLE The homeodomain factor Gbx1 is required for locomotion and cell specification in the dorsal spinal cord JOURNAL PeerJ 1, e142 (2013) PUBMED 24010020 REMARK Publication Status: Online-Only REFERENCE 2 (bases 1 to 1831) AUTHORS Buckley DM, Burroughs-Garcia J, Lewandoski M and Waters ST. TITLE Characterization of the Gbx1-/- mouse mutant: a requirement for Gbx1 in normal locomotion and sensorimotor circuit development JOURNAL PLoS One 8 (2), e56214 (2013) PUBMED 23418536 REFERENCE 3 (bases 1 to 1831) AUTHORS Obinata A, Osakabe K, Yamaguchi M, Morimoto R and Akimoto Y. TITLE Tgm2/Gh, Gbx1 and TGF-beta are involved in retinoic acid-induced transdifferentiation from epidermis to mucosal epithelium JOURNAL Int J Dev Biol 55 (10-12), 933-943 (2011) PUBMED 22252490 REMARK GeneRIF: Tgm2/Gh, Gbx1 and TGF-beta are involved in retinoic acid-induced transdifferentiation from epidermis to mucosal epithelium REFERENCE 4 (bases 1 to 1831) AUTHORS Rhinn M, Lun K, Werner M, Simeone A and Brand M. TITLE Isolation and expression of the homeobox gene Gbx1 during mouse development JOURNAL Dev Dyn 229 (2), 334-339 (2004) PUBMED 14745958 REFERENCE 5 (bases 1 to 1831) AUTHORS Asbreuk CH, van Schaick HS, Cox JJ, Kromkamp M, Smidt MP and Burbach JP. TITLE The homeobox genes Lhx7 and Gbx1 are expressed in the basal forebrain cholinergic system JOURNAL Neuroscience 109 (2), 287-298 (2002) PUBMED 11801365 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000141.1. On Sep 26, 2012 this sequence version replaced XM_001063850.3. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates and exon combination used for the transcript record were based on alignment to full-length mouse mRNAs AF547996.1 and AY319256.1. ##Evidence-Data-START## RNAseq introns :: single sample supports all introns SAMN09345330, SAMN13663605 [ECO:0000348] ##Evidence-Data-END## ##RefSeq-Attributes-START## inferred exon combination :: based on alignments, homology RefSeq Select criteria :: based on single protein-coding transcript ##RefSeq-Attributes-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1113 JACYVU010000141.1 266178-267290 1114-1831 JACYVU010000141.1 291990-292707 FEATURES Location/Qualifiers source 1..1831 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN" /db_xref="taxon:10116" /chromosome="4" /map="4q11" gene 1..1831 /gene="Gbx1" /note="gastrulation brain homeobox 1" /db_xref="GeneID:246149" /db_xref="RGD:621864" exon 1..1113 /gene="Gbx1" /inference="alignment:Splign:2.1.0" misc_feature 375..377 /gene="Gbx1" /note="upstream in-frame stop codon" CDS 387..1664 /gene="Gbx1" /note="gastrulation brain homeo box 1" /codon_start=1 /product="homeobox protein GBX-1" /protein_id="NP_001258382.1" /db_xref="GeneID:246149" /db_xref="RGD:621864" /translation="
MSPEGDTPSPPARPLPPYERGSAAPEPHCAEPAPRRYLGPRARSEPCVSAPGARRGPGSAMQRAAGGGAPGGSGGSGGGPGTAFSIDSLIGPPPPRSGHLLYTGYPMFMPYRPLVLPQALAPAPLPAGLPPLAPLASFAGRLSNTFCAGLGQAVPSMVALTTALPSFAEPPDAYYGPPELAAAAAAAAASTVSRSNPEPPARRTDGALDADELLPAREKVTEPPPPPPPPPPHFSETFPSLPAEGKVYSSDEEKLEPPAGEPAGSEPEEEGSGGDSEDSFLDSSAGGPGALLGPKPKLKGSLGTGAEEGTPVATGVTTPGGKSRRRRTAFTSEQLLELEKEFHCKKYLSLTERSQIAHALKLSEVQVKIWFQNRRAKWKRIKAGNVSSRSGEPVRNPKIVVPIPVHVNRFAVRSQHQQMEQGARP"
misc_feature order(1356..1370,1374..1376,1425..1427,1443..1445, 1482..1484,1488..1493,1500..1505,1509..1517,1521..1526) /gene="Gbx1" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:238039" misc_feature 1362..1523 /gene="Gbx1" /note="Homeobox domain; Region: Homeobox; pfam00046" /db_xref="CDD:425441" misc_feature order(1362..1364,1371..1373,1491..1493,1500..1505, 1512..1514) /gene="Gbx1" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:238039" exon 1114..1831 /gene="Gbx1" /inference="alignment:Splign:2.1.0" ORIGIN
gcgccgcgtcctgactcctacggatcgccactccgtgcgccctgagtcgctcctggcgtcccacgcgcccccgccccgccccgccgcgcccctctcgcccttcgagccgcgccgagcccgggtcctgtgggctgagccgggagcaggtccgggcgcggggaggggacctggccagctgccgccgccgcctcctcgcccgccgcaaactttcacaaagcggcgggtccggcctcatcaatctgcattaataatagttggttgggccgcggggggcgggcggggtcccgggccggccgggccactgggaaggcgcggggcgcggggcgcgggagccgggcgcggcggcgggcggagggagcaagtgaagcgtaatttgaggaagatggatgagtccggagggcgacacccccagcccgcccgcccgccccctccctccttatgagcgagggagcgcggcgccggagccacactgcgccgagcccgcgccccgccgctacctcggcccgcgcgcccgcagcgagccctgcgtgtccgcgccgggcgcacggcggggcccgggcagcgccatgcagagagcggcgggcggcggcgcccccgggggcagcggcgggagcggcggcggccccggcaccgccttctccatcgactcgctcatcgggccgccgccgccgcgctcgggccacctgctctacactggctaccccatgttcatgccctaccggccgctcgtgctgccgcaggcgctggccccggcgccgctgcccgccggcctgccgccgctggccccgctcgcctcgttcgcgggccgcctgagcaacaccttctgcgcggggctgggccaggcggtgccctcgatggtggcgctgaccactgcactgcccagcttcgcagagccccccgacgcctactacggacccccggagctcgccgccgccgccgccgccgccgccgcctccaccgtctcgcgaagcaacccggagcccccggcccggcgcacagacggagcgctggatgcggacgagctgctgcctgcgcgcgagaaagtgactgagcctccgccgcccccgccgcccccgcctccgcacttctcagagactttcccgagtctgccggcagaggggaaggtgtacagctcagatgaggagaagctggagcccccagcaggagagccagcaggcagcgagccggaggaagaaggctcaggcggtgacagcgaggacagcttcctggacagttctgcagggggcccaggggctcttctgggacctaaaccgaagctaaagggaagcctggggactggcgcagaggaggggacaccagtggccacaggggtcaccacgcctggggggaaaagccgaaggcggcgcacagccttcactagcgagcagcttttggagctggagaaggagtttcactgcaagaaatacctgagtctgaccgagcgctcccagatcgcccacgccctcaagctcagcgaggtgcaggtgaagatctggtttcagaaccgccgggccaagtggaagcgaatcaaggctggcaatgtgagcagccgttctggggagcccgtgagaaaccccaagatcgtagtgcccatacctgtgcacgtcaacaggtttgctgtgcgcagccagcaccaacagatggagcagggggcccggccatgaccaagctcccggggaccgaagtcaacggatctgaacctgtgcctgcccaagactcactgggtgctgcagcctagaggggcctggtggactctgttctgggaaagaccagcgtgttcccaggactgcggcatgagtattcggccagagactgttctcgagacctcagg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]