LOCUS       XM_039104462             500 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus RNA polymerase II subunit I (Polr2i),
            transcript variant X1, mRNA.
ACCESSION   XM_039104462
VERSION     XM_039104462.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051336.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..500
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="1"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..500
                     /gene="Polr2i"
                     /note="RNA polymerase II subunit I; Derived by automated
                     computational analysis using gene prediction method:
                     Gnomon. Supporting evidence includes similarity to: 8
                     ESTs, 10 long SRA reads, and 100% coverage of the
                     annotated genomic feature by RNAseq alignments, including
                     119 samples with support for all annotated introns"
                     /db_xref="GeneID:292778"
                     /db_xref="RGD:1309395"
     CDS             148..459
                     /gene="Polr2i"
                     /codon_start=1
                     /product="DNA-directed RNA polymerase II subunit RPB9
                     isoform X1"
                     /protein_id="XP_038960390.1"
                     /db_xref="GeneID:292778"
                     /db_xref="RGD:1309395"
                     /translation="

MLYPKEDKENRILLYACRNCDYQQEADNSCIYVNKITHEVDELTQIIADVSQDPTLPRTEDHPCQKCGHKEAVFFQSHSARAEDAMRLYYVCTAPHCGHRWTE"

     misc_feature    148..456
                     /gene="Polr2i"
                     /note="DNA-directed RNA polymerase, subunit
                     M/Transcription elongation factor TFIIS [Transcription];
                     Region: RPB9; COG1594"
                     /db_xref="CDD:224510"
     misc_feature    301..453
                     /gene="Polr2i"
                     /note="C-terminal zinc ribbon domain of RPB9 subunit of
                     RNA polymerase II; Region: Zn-ribbon_RPB9; cd10508"
                     /db_xref="CDD:259793"
     misc_feature    order(301..303,307..312,316..318,370..375,379..381,
                     403..411)
                     /gene="Polr2i"
                     /note="trimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:259793"
     misc_feature    order(337..339,346..348,421..423,436..438)
                     /gene="Polr2i"
                     /note="Zn binding site [ion binding]; other site"
                     /db_xref="CDD:259793"
ORIGIN      

caaaggatagacgcaagccgtcagccagacatccataagataaggagccctcacgtgcacgcagctccgccccattttagtgcagctacgcgatccgacccttcccgcggtccgtagcgcggccgcgcaagcgcagaaagtaataacatgctgtaccccaaggaggacaaggagaatcgcattctgctgtacgcgtgccggaattgcgattaccagcaggaagccgacaacagctgcatctacgtcaacaaaatcacgcacgaagtggacgagctgacccagatcatcgcagacgtgtcccaggaccctacgttgccccggaccgaggaccacccgtgccagaagtgtggccacaaggaggcagtgttcttccagtcacacagtgcccgagctgaggatgccatgcgcctgtactatgtatgcaccgccccacactgcggccaccgctggactgagtgaccgttccttcctccatttgtaataaatgcccagtttccaca

//