2024-04-29 23:04:49, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039098335 1827 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus zinc finger protein 431-like (LOC103690914), transcript variant X4, mRNA. ACCESSION XM_039098335 VERSION XM_039098335.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051336.1) annotated using gene prediction method: Gnomon. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1827 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="1" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..1827 /gene="LOC103690914" /note="zinc finger protein 431-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 long SRA read, 5 Proteins, and 67% coverage of the annotated genomic feature by RNAseq alignments, including 15 samples with support for all annotated introns" /db_xref="GeneID:103690914" /db_xref="RGD:9213653" CDS 134..1690 /gene="LOC103690914" /codon_start=1 /product="zinc finger protein 431-like isoform X3" /protein_id="XP_038954263.1" /db_xref="GeneID:103690914" /db_xref="RGD:9213653" /translation="
MQETYRNLTAIGYNWEDHSIEEHCQSFRRHGRHERCHTGEKPSENTQCGKAFAQHSRLQRHKNTHTGEKLCECKPHDKAFTYDSQLQTLERIHSGEKPYKYNQCGKAFERRCNLGRHKLIHTGRKSYKCNQCGKAFSQNSHLQTHKSTHTREELYKCKQCGKAFTCHNELQSHKRIHTGEKSYECNQCGKAFKSHRYLQVHKAIHTGEKPYVCDQCGKAFARLSHLKTHGITHSGKKPCKCDQCGKAFASHSYLQVHKRIHTGEKPYVCDRCGKAFASHSYLQVHKRIHTGEKPYVCDWCGKAFASHSYLQVHKRIHTGEKPYVCDRCDKAFAYHSYLQVHKRIHTGEKLYECDQCGKAFASHSYLQVHKKIHTGEKPYVCDQCGKDFVVQSDLKRHKRTHTGEKPYKCNECGKAFVGQNDLKKHKRKHTGEKPYEYNECGKAFVGQNSLKRHERIHTGEKPYECNECGKAFVGQSNLKGHERIHGGEKPYECNECGKGFVCNDRLQTHKAIHTGVKP"
misc_feature 254..1492 /gene="LOC103690914" /note="FOG: Zn-finger [General function prediction only]; Region: COG5048" /db_xref="CDD:227381" misc_feature 266..319 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 362..412 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 437..496 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 518..580 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(518..520,527..529,566..568,578..580) /gene="LOC103690914" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" misc_feature 602..664 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(602..604,611..613,650..652,662..664) /gene="LOC103690914" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" misc_feature order(617..619,623..625,629..631,635..640,647..652, 659..661,701..703,707..709,719..724,731..736,743..745, 785..787,791..793,797..799,803..808,815..820,827..829) /gene="LOC103690914" /note="putative nucleic acid binding site [nucleotide binding]; other site" /db_xref="CDD:275368" misc_feature 686..748 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 770..832 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 854..916 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(854..856,863..865,902..904,914..916) /gene="LOC103690914" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" misc_feature order(869..871,875..877,881..883,887..892,899..904, 911..913,953..955,959..961,971..976,983..988,995..997, 1037..1039,1043..1045,1049..1051,1055..1060,1067..1072, 1079..1081) /gene="LOC103690914" /note="putative nucleic acid binding site [nucleotide binding]; other site" /db_xref="CDD:275368" misc_feature 938..1000 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1022..1084 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1106..1168 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1190..1252 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(1190..1192,1199..1201,1238..1240,1250..1252) /gene="LOC103690914" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" misc_feature 1274..1336 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1358..1420 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature order(1358..1360,1367..1369,1406..1408,1418..1420) /gene="LOC103690914" /note="Zn binding site [ion binding]; other site" /db_xref="CDD:275368" misc_feature order(1373..1375,1379..1381,1385..1387,1391..1396, 1403..1408,1415..1417,1457..1459,1463..1465,1475..1480, 1487..1492,1499..1501,1541..1543,1547..1549,1553..1555, 1559..1564,1571..1576,1583..1585) /gene="LOC103690914" /note="putative nucleic acid binding site [nucleotide binding]; other site" /db_xref="CDD:275368" misc_feature 1442..1504 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1478..1552 /gene="LOC103690914" /note="Zinc-finger double domain; Region: zf-H2C2_2; pfam13465" /db_xref="CDD:433230" misc_feature 1526..1588 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" misc_feature 1610..1672 /gene="LOC103690914" /note="C2H2 Zn finger [structural motif]; Region: C2H2 Zn finger" /db_xref="CDD:275368" ORIGIN
tggctatattgcctgagttttctgagtcattggattgcaggatgcattgacctatgatgatgtacatgtgaacttcactcgagaagaatgggctttgctggatccttcacagaagagtctctacaaagatgtgatgcaggagacctacaggaacctcactgctataggttacaattgggaagaccatagtattgaagaacattgtcaaagtttcagaagacatggaaggcatgaaagatgtcatactggagagaaaccatctgaaaatactcagtgtggtaaagcctttgcacaacatagtcgtctccaaagacataaaaacacacatactggagagaaactctgtgaatgtaagccacatgataaagcctttacatacgattctcagcttcaaactcttgaaaggattcatagtggagaaaaaccctacaaatataatcaatgtggtaaagcctttgaacgtcgttgtaatcttggaaggcataaactaatacatactggaagaaaatcctacaaatgcaatcagtgtggtaaagccttttcacaaaacagtcatctccaaacacataaaagcacacatactagagaggaactctataaatgtaagcaatgcggtaaagcctttacatgccataatgaacttcaaagtcataaaaggattcatactggagagaaatcctacgaatgcaatcagtgtggtaaagcctttaaatctcataggtatctccaagtacataaagcaatacatactggagagaagccctatgtatgtgatcaatgtggtaaagcctttgcacgactcagtcatctcaaaacgcatggaataacacatagtggaaagaagccttgtaagtgtgatcaatgtggtaaagcctttgcatctcatagttatctccaagtacataaaagaatacatactggagagaagccctatgtatgtgatcggtgtggtaaagcctttgcatctcatagttatctccaagtacataaaagaatacatactggagagaagccctatgtatgtgattggtgtggtaaagcctttgcatctcatagttatctccaagtacataaaagaatacatactggagagaagccctatgtatgtgatcggtgtgataaagcctttgcatatcatagttatctccaagtacataaaagaatacatactggagagaagctctatgaatgtgatcaatgtggtaaagcctttgcatctcatagttatctccaagtacataaaaaaatacatactggagagaagccctatgtatgtgatcaatgtggtaaagactttgtagttcagagtgatcttaaaagacataaaagaacacatactggagagaaaccttacaaatgtaatgaatgtggtaaggcctttgtaggtcagaatgatcttaaaaaacataaaagaaaacatactggcgagaaaccttatgaatataatgaatgtggtaaagcctttgtaggtcagaatagccttaaaaggcatgaaagaattcatactggagagaaaccttatgaatgtaatgaatgtggtaaagcctttgtaggtcagagtaaccttaaagggcatgaaagaattcatggtggagagaaaccttatgaatgtaatgaatgtggtaaaggctttgtatgtaacgatagactccaaacacataaagcaatacatactggagtgaaaccttaagaatgtaagcaatatggtaaagcctttgtaggtcagaatgaccttaaaaggcatgaaagaattcatactggagagaaaccttacaaatgtaatgaatgtggtaaagcctttgtatgtaatgctagtctccgaaaaca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]