2024-04-29 06:41:12, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039091359 1519 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus heterogeneous nuclear ribonucleoprotein A3-like (LOC120096281), mRNA. ACCESSION XM_039091359 VERSION XM_039091359.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051348.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1519 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="13" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..1519 /gene="LOC120096281" /note="heterogeneous nuclear ribonucleoprotein A3-like; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 20 ESTs, 3 long SRA reads, 21 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments" /db_xref="GeneID:120096281" /db_xref="RGD:41086608" CDS 63..1136 /gene="LOC120096281" /codon_start=1 /product="heterogeneous nuclear ribonucleoprotein A3-like" /protein_id="XP_038947287.1" /db_xref="GeneID:120096281" /db_xref="RGD:41086608" /translation="
MEGHDPKEPEQLRKLFIGGLSFETTDDSLREHFEKWGTLTDCVVMRDPQTKRSRGFGFVTYSCVEEVDAAMCARPHKVDGRVVEPKRAVSREDSVKPGAHLTVKKIFVGGIKEDTEEYNLRDYFEKYGKIETIEVMEDRQSGKKRGFAFVTFDDHDTVDKIVVQKYHTINGHNCEVKKALSKQEMQSAGSQRGRGGGSGNFMGHGGNFGGGGGNFGRGGNFGGRGGYGGGGGGSRGSYGGGDGGYNGFGGDGGNYGGGPGYSSRGGYGGGGPGYGNQGGGYGGGGGGYDGYNEGGNFGGGNYGGGGNYNDFGNYSGQQQSNYGPMKGGSFGGRSSGSPYGGGYGSGGGSGGYGSRRF"
misc_feature 93..335 /gene="LOC120096281" /note="RNA recognition motif 1 (RRM1) found in heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) and similar proteins; Region: RRM1_hnRNPA3; cd12763" /db_xref="CDD:410156" misc_feature order(102..104,108..110,114..119,183..185,189..191, 195..197,222..230,234..236,303..305,312..314,318..335) /gene="LOC120096281" /note="putative DNA binding site [nucleotide binding]; other site" /db_xref="CDD:410156" misc_feature 372..611 /gene="LOC120096281" /note="RNA recognition motif 2 (RRM2) found in heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) and similar proteins; Region: RRM2_hnRNPA3; cd12582" /db_xref="CDD:409996" misc_feature 990..>1040 /gene="LOC120096281" /note="Nuclear factor hnRNPA1; Region: HnRNPA1; pfam11627" /db_xref="CDD:431967" ORIGIN
aatttaggaattcttgggtcccatattgaactcgagttggaagaggcgagtccggtctcaaaatggagggccacgatccaaaggaaccagagcagctgaggaagctgtttattggtggtctgagctttgaaaccacagatgatagcttaagagaacattttgagaaatggggcacacttacagattgtgtggtaatgagagatcctcaaacaaaacgttccagaggctttggttttgtgacctactcttgtgtcgaagaggtggatgctgcaatgtgtgctcggccacacaaggttgatggacgtgtggtggaaccaaagagagctgtttctagagaggattctgtaaagcctggtgcccatttaacggtgaagaagatttttgttggtggtattaaagaggatacagaagaatataatctgagagactactttgaaaagtatggcaagattgaaaccatagaagttatggaagataggcagagtgggaaaaagagaggatttgcttttgtaacttttgatgatcatgacacagttgataaaattgttgttcagaaataccacactattaatgggcataattgtgaagtgaaaaaggccctttctaaacaagagatgcagtctgctggatcacagagaggtcgtggaggtggatctggcaactttatgggacatggaggaaactttggtggtggcggaggaaactttgggcgtggaggaaactttggtggaagaggaggctatggtggtggaggtggtggcagcagaggcagttatggaggtggtgatggtggatataatggatttggaggtgatggtggcaactatggtggtggtcctggttacagtagtagaggaggttatggaggtggtggaccaggatatggaaaccaaggtggtggatatggtggtggaggaggaggatatgatggttacaatgaaggaggaaattttggtggaggtaactatggtggtggtgggaactataatgactttggaaattatagtggacagcaacaatctaattatggacccatgaaggggggcagttttggtggaagaagctcaggcagtccctatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaattaaggaatttttaacttttcaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]