GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-04-29 10:10:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_039087679            1505 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus heterogeneous nuclear
            ribonucleoprotein A3-like (LOC100911361), mRNA.
ACCESSION   XM_039087679
VERSION     XM_039087679.1
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051345.1) annotated using gene prediction method: Gnomon,
            supported by mRNA and EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1505
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="10"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..1505
                     /gene="LOC100911361"
                     /note="heterogeneous nuclear ribonucleoprotein A3-like;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 1 mRNA, 18 ESTs, 3 long SRA reads, 17
                     Proteins, and 100% coverage of the annotated genomic
                     feature by RNAseq alignments"
                     /db_xref="GeneID:100911361"
                     /db_xref="RGD:6493616"
     CDS             61..1134
                     /gene="LOC100911361"
                     /codon_start=1
                     /product="heterogeneous nuclear ribonucleoprotein A3-like"
                     /protein_id="XP_038943607.1"
                     /db_xref="GeneID:100911361"
                     /db_xref="RGD:6493616"
                     /translation="
MEGHDPKEPEQLRKLFIGGLSFETTDDSLREHFEKWGTLTDCVVMRDPQTKRSRGFGFVTYSCVEEVDAAMCARPHKVDGRVVEPKRAVSREDSVKPGAHLTVKKIFVGGIKEDTEEYNLRDYFEKYGKIETIEVMEDRQSGKKRGFAFVTFDDHDTVDKIVVQKYHTINGHNCEVKKALSKQEMQSAGSQRGRGGGSGNFMGRGGNFGGGGGNFGRGGNFGGRGGYGGGGGGSRGSYGGGDGGYNGFGGDGGNYGGGPGYSSRGGYGGGGPGYGNQGGGYGGGGGGYDGYNEGGNFGGGNYGGGGNYNDFGNYSGQQQSNYGPMKGGSFGGRSSGSPYGGGYGSGGGSGGYGSRRF"
     misc_feature    91..333
                     /gene="LOC100911361"
                     /note="RNA recognition motif 1 (RRM1) found in
                     heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) and
                     similar proteins; Region: RRM1_hnRNPA3; cd12763"
                     /db_xref="CDD:410156"
     misc_feature    order(100..102,106..108,112..117,181..183,187..189,
                     193..195,220..228,232..234,301..303,310..312,316..333)
                     /gene="LOC100911361"
                     /note="putative DNA binding site [nucleotide binding];
                     other site"
                     /db_xref="CDD:410156"
     misc_feature    370..609
                     /gene="LOC100911361"
                     /note="RNA recognition motif 2 (RRM2) found in
                     heterogeneous nuclear ribonucleoprotein A3 (hnRNP A3) and
                     similar proteins; Region: RRM2_hnRNPA3; cd12582"
                     /db_xref="CDD:409996"
     misc_feature    988..>1038
                     /gene="LOC100911361"
                     /note="Nuclear factor hnRNPA1; Region: HnRNPA1; pfam11627"
                     /db_xref="CDD:431967"
ORIGIN      
tttcttgtcctctcggtcccatattgaactcgagttggaagaggcgagtccggtctcaaaatggagggccacgatccaaaggaaccagagcagctgaggaagctgtttattggtggtctgagctttgaaaccacagatgatagcttaagagaacattttgagaaatggggcacacttacagattgtgtggtaatgagagatcctcaaacaaaacgttcgagaggctttggttttgtgacctactcttgtgtcgaagaggtggatgctgcaatgtgtgctcggccacacaaggttgatggacgtgtggtggaaccaaagagagctgtttctagagaggattctgtaaagcctggtgcccatttaacggtgaagaagatttttgttggtggtattaaagaggatacagaagaatataatctgagagactactttgaaaagtatggcaagattgaaaccatagaagttatggaagataggcagagtgggaaaaagagaggatttgcttttgtaacttttgatgatcatgacacagttgataaaattgttgttcagaaataccacactattaatgggcataattgtgaagtgaaaaaggccctttctaaacaagagatgcagtctgctggatcacagagaggtcgtggaggtggatctggcaactttatgggacgtggaggaaactttggtggtggcggaggaaactttgggcgtggaggaaactttggtggaagaggaggctatggtggtggaggtggtggcagcagaggcagttatggaggtggtgatggtggatataatggatttggaggtgatggtggcaactatggtggtggtcctggttacagtagtagaggaggttatggaggtggtggaccaggatatggaaaccaaggtggtggatatggtggtggaggaggaggatatgatggttacaatgaaggaggaaattttggtggaggtaactatggtggtggtgggaactataatgactttggaaattatagtggacagcaacaatctaattatggacccatgaaggggggcagttttggtggaagaagctcaggcagtccctatggtggtggctatggatctggaggtggaagtggtggatatggtagcagaaggttttaaaataaaacaaacggctacagttcttagcaggagagagagcgaggagttgtcaggaaagctgcaggttactttgagacagtcgtcctaaatgcattagaggaactgtaaaaatctgccacagaaggaacgatgatccatagtcagaaaagttactgcagcttaaacaggaagcccttcttgttcaggactgtcatagccacagtttgcaaaagtgcagctatcgattaatgcaatgtagtgtcaattagatgtacattcctgaggtcttttatctgttgtagctttgtctttttctttttcttttcattacatcaggtatattgccctgtaaattgtggtagtggtaccaggaataaaaaattaaggaattt
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]