2024-05-01 17:00:28, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039087256 14358 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF (Obscn), transcript variant X35, mRNA. ACCESSION XM_039087256 VERSION XM_039087256.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051345.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..14358 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="10" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..14358 /gene="Obscn" /note="obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 1 mRNA, 23 ESTs, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 6 samples with support for all annotated introns" /db_xref="GeneID:338458" /db_xref="RGD:631335" CDS 193..14304 /gene="Obscn" /codon_start=1 /product="obscurin isoform X33" /protein_id="XP_038943184.1" /db_xref="GeneID:338458" /db_xref="RGD:631335" /translation="
MVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPKFTEGLKKEEATEGNMATLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAACELQIRGLALEDAGEYSCLCGQEKTSATLSVKALPPRFIEDLRSQEATEGNMVTLRCQMSKVTPVEWRKGSETLRDGGRYSLRQDGAVCELQIHRLALEDAGEYSCLCGQEKTSATLSVKALPPRFTEDLRSQKATEGTMVTLRCQMSKAAPVEWRKGSETLRDGGRYSLRQDGAVYELQIRGLALEDAGEYSCVCGQEKTSATLSVKALPARFIEDLRSQEVPESSTVTMRCELSKKAPVVWRKGSETLKNGARYSLRQDGAVCELEIRDLTVEDAGEYSCTCGKERTSATLSIMAPQVVFQKLLENLQAEEGSTASLRCELSVPNTAVVWSKGGLELQADTCRETRQQGCVAELLLRDVRREDAGEYSCTCGSQTTSATLMVTAAPVRFLQELQAQDVDEGTTARLRCELSREAASVEWRKGSLQLFPCAKYQMVQEGTTAELLVHGVEQEDAGEYTCDAGHMQSIARLSVRAPKPKFKTGLQSKEQEAGGTARLCCQLSEAESGTPVQWLKEGVELHVSSKYEMRCQGAMCELLIHKLEAKDTGEYACVVGGQKTLASLRVKEPEVTIVQGLVDMEVQADEDVEFTCKVSQAGATDVQWHLQGLPLQSNEVTEVAVLGDGCTHVLQLKGVTLDDAGTVSFHVGSHSSSAQLIVRVPEVTVLEPLKDVQLSEGQDAHFQCRLSRASGQEARWALGGVPLQCNEMNDITVEQGTLYSLTLHKVTLEDAGTITLQVGSCSSEAQLKVTEAALCLVRGLQNVDVFAGEVATFSCEVSRAGGPEARWWLDGTLLQNSPESAMTVREGTVHSLTLSGLGVADSGTITFRTGPLVSTAKLLVKDPTVEVVSAMQDLVVEEGGSAELLCQYSRPVQAMWKMNEREVCADGHRVIIEQDWTVARLTLRPALPCDSGIYSCEAAGTRVVALLQVQAKNTVVRGLENVDALEGGEALFECQLSQPEVAAHTWLLDDEPVHTSANVEVVYFENGLRHLLLLKNLKPQDSCRVTFLAGDVVTSAFLTVRGWRLEVLEPPQDASVKAGTQVCFTCILSEALPVGEATWYINGAAIQPDDADWIVTADGSHHALTLSNAQPQHAGEVTFAARDAVASARLSVLALPGPPEDAEVVGRSDHSVTLSWVAPVSDGGGGLCGYRVEMKEASTGQWQLCHELVPGPECVVDGLVSGKTYRFRVAAVGPAGAGEPVHLPQMVKIAEPMEPKPAPAPAPALAPTPAPIPTPAPAPAPAPTPAPTPTPAPAPAPAPAPATRRAVVGEDVCLELEVAADAGEVVWHKGTERIHPSGHFEVLSQGQRQMLVIKGFRTEDQGEYRCGPIQGLPSSGASTFNVVVTSGSEDEVPAQPSLPPEAAQEGDLHLLWEALARKRRMSREPTLDSISELPEEDSRVQHLRQEAEEAAPDLSEGYSTADELARTGEADLSHTSSDDESRAGTPSLITYLKKAGGPGISPLASKHEAQVATSVKPQKQQERVVPTCPLPGDLNAADLKDPSLDKAAVKIQAAFKGYKVRKEMKQQGGPVFSRTFGDTEAQVGDALRLECVVSTKADVRACWLKDGVELTDGRHYHIDQLKDGTCSLLVTGLGPTDSGRYTCQVSTKFGSVSHSACVMVSGTESEAESSSGGELDDAFRRAARRLHRLFRTKSPAELSEEELFLSADEGPMEPEEPADWQTYREDENFVCIRFESLAEAHRAVTCFRDMFATMGIGVEISLGEQGPRGVEMRIGKVAPTVIPAVPLAKTPGLQTSDAAPVFLTELQNQDVQDGYPMSFDCVVTGQPVPSVRWFKDGKLLEEDDHYMINEDQQGGHQLIITAVVPADMGVYRCLAENSMGVSSTKAELRVELTSTDYDTAADATETSSYFSAQGYLSSREQEGTESDEGQLPQVLEELKDLQVAPGTRLAKFQLKVKGYPAPKLYWFKDGQPLTTSDHIRMTDKKTLHTLEIVSITREDSGQYAAYISNAVGAAYSSARLLVRGPSEPEEKPQPDVHERLVPPRILEKFTPKKVKRGSSITFSVKVEGHPAPSVHWLKEEAEKGVLWIGPDTPGYTMASSSKQHSLVLLDVGRQHQGTYTCIATNAAGQALCSASLHISGLAKEEEQERVKEALISSFLQGTSQAVSAQMSESASFADLVGQRKGESLVAEEAHSHLSLSEVGTEEFLQKLTSQITEMVSAKISQAKLQVPGGDSDEESKTPSASPRHGRSRPSSSVQESSSESEDGDSRGEIFDIYVVTADYLPLGAEQDAIILREGQYVEVLDSAHPLRWLVRTKPTKSSPSRQGWVSPAYLDKRLKLSPEWGPTEAPEFPGEAVSEDEYRTRLSSVIQELLSSEQAFVGELQFLESHHIKHLDRSPRVPAAVASQKTVIFRNVQDISHFHSSFLKELQSCGTDDDVAMCFIKNQEAFEKYLEFLVGRVQAESVVVSTPVQEFYKKYAEEMLSAKDPTQPPPPPLQHYLEQPVERVQKYQALLKELIRNKARNRQNCALLEQAYAVVSALPQRAENKLHVSLMENYPGTLEALGEPIRQGHFIVWEGAPGARMPWKGHNRHVFLFRNHLVICKPRRDSRTDTFSYVFRNMMKLNSIDLNDQVEGDDRAFEVWHEREDSVRKYLLQARTVIIKNSWVKEICGIQQRLAQPVWRPPEFEEELADCTAELGETVKLACRVTGTPKPIVSWYKDGKPVEVDPHHILIEDPDGSCTLILDNLTGIDSGQYMCFAASAAGNASTLGKILVQVPPRFVNKVRATPFVEGEDAQITCTVEGAPYPQIRWYKDGALLTLGNRYRMVNEPRSGMLVLVIQAASKEDLGHYECELVNRLGSTRCGGELYMQSPALRAWDQHHREQLVAAVEDASMEDSAHPTQEGADQQAASVLWRLLGSEALSPSPGGFPNTRQSEPPTSEEAAPQIPGTTSGTPGKLPEASRPGTYKGLEQGMTTTSGSQERNVPIRVEGTAWPGGGTGQLLLDVHSQVIMETTQRTYVCQAPDTGVTRAPSMQVTIEDLQVQVGDMAQFDAVIEGNPPPTVTWYKDSNQLVNGTRLRQQQGGTTYSLVLMDVTPHDAGVYTCVAQNAGGQVLCKAELLVYGGDKSDAEKQAYRRKLHSFYEVQEEIGRGVFGFVKRVQHKGNKMSCAAKFIPLRSKTRAQAYQERDILATLSHPLVTGLLDQFETQKTLILILELCSSEELLDRLFKKAVVTEAEVKVYIQQLVEGLHYLHSHDILHLDIKPPNILMVHPAREDIKICDFGFAQKITPSEPQYSKYGSPEFVSPEIIEQSPVSEGSDIWAMGVISYLSLTCSSPFAGESDRATLLNVLEGRVSWSSPMAAHLSEDAKDFIKATLQKTPRARPSASQCLAHPWFLKSMPAEEAHFINTKQLKFLLARSRWQRSLMSYKSILVMRSIPELLQGPPDSPSLGVARHLRGEASGSSSSSSSSDNELAPFARAKSLPPSPVTHSPLLHPRGFLRPSASLPEETEASMSTADAAMPAPPQSAGPPASPGCVPRHSVISSLFYQQAGEGAERGSKALGAKRHPARRRHLLKGGYIARALPGLREPLMEFSVLEEEAANEEQASLMTKTPSFETALRLPSSNVREVPGRSRSLDNPPGTASPSPEAYKEQYLSPPSSGLTHETTAKGMGHKEGFLQESVPFSPTSGDLRPVKQEGSSQDSCRGKPASSCHSELGSGPQEGCGSPSSQLCGSLPPQSSKKELSKPCGPLFSEQPQAAPFPAQASPLLGSQKEPQDSYLPEKPCPVPSSSPGSASQVDASLDTEGLSEAGDTCDFTPPLQRPQEQATTRKFSLESRGGYAGVAGYGTFAFGGDAGGMLGQGPLWARMAWAVSQSSEEQDEAATESPQPLDSSGPIAEASGVPLRTSPSLTPWEEVEQVSLVQIRDLSGDAEAADTISLDISEVDPAYLNLSDLYDIKYLPFEFMIFRRVPKPVEQPESPGSETEEGQGLAEFLEEAVWPWPGELGLRAGLEITEEPQEPGDLEALLGEAAVGRKRKWSPSRGLFQFPGRCLSGEEPVELGLRQRVKASMAHISRILKGKPEGPEKEGPPRKKAGLASFRLSGLKGRDQAPSFLRELSDEAVVLGQSVTLACQVLAQPTAQATWSKDGALLESSGHLLISSTLKNFQLLTILVVTEEDLGTYTCCVSNPLGTAVTTGVLRKAERPSSSPRPEVGELYTDAVLLVWKPVESYGPVTYIVQCCIEGGSWTTLASDISDCCYLTGKLPRGGMYTFRTACVSKAGMGPYSSPSEQVLLGGPNHLASEEESSRGRPAQLLPSTKTFAFQTQIRRGRFSVVRQCREKASGRALAAKIVPYQPEDKTTVLREYEALKRLHHPHLAQLHAAYLSPRHLVLILELCSGPELLPSLAERDSYSESDVKDYLWQMLSATQYLHAQHILHLDLRSENMMVTEYNLLKVIDLGNAQSLSQEKVPPPENFKDYLETMAPELLEGQGAVPQTDIWAIGVTAFIMLSGEYPVSSEGTRDLQKGLRKGLIQLSRCYAGLSGGAVAFLQSSLCARPWGRPCASTCLQCGWLTEEGPTGSRPTPVTFPTARLRAFVREREKRRALLYKKHNLAQVR"
misc_feature 196..396 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 196..210 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 232..243 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 304..318 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 409..660 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 460..474 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 493..507 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 568..582 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 610..627 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 637..648 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 673..924 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 724..738 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 832..846 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 874..888 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 901..912 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 937..1188 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 988..1002 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1021..1035 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1096..1110 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1138..1155 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1165..1176 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1204..1452 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1252..1266 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1288..1299 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1360..1374 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1402..1419 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1429..1440 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1468..1719 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1516..1530 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1552..1566 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1627..1641 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1669..1686 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1696..1707 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 1735..1986 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 1783..1797 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 1819..1833 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 1894..1908 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 1936..1953 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 1963..1974 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2035..2259 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2050..2064 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2092..2106 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2167..2181 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2209..2226 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 2236..2247 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2278..2535 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2323..2337 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2362..2376 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2437..2457 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2542..2808 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2599..2613 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2638..2652 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2716..2730 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 2785..2796 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 2830..3045 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 2872..2886 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 2911..2925 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 2989..3003 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3115..3315 /gene="Obscn" /note="Immunoglobulin like; Region: IG_like; smart00410" /db_xref="CDD:214653" misc_feature 3145..3159 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3178..3192 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3256..3270 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3298..3315 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3364..3621 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3637..3897 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 3685..3699 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 3727..3741 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 3805..3819 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 3847..3864 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 3874..3885 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 3907..4164 /gene="Obscn" /note="Fibronectin type 3 domain; One of three types of internal repeats found in the plasma protein fibronectin. Its tenth fibronectin type III repeat contains an RGD cell recognition sequence in a flexible loop between 2 strands. Approximately 2% of all...; Region: FN3; cd00063" /db_xref="CDD:238020" misc_feature order(3907..3909,4102..4104,4147..4149) /gene="Obscn" /note="Interdomain contacts [active]" /db_xref="CDD:238020" misc_feature order(4150..4155,4159..4164) /gene="Obscn" /note="Cytokine receptor motif [active]" /db_xref="CDD:238020" misc_feature 4354..4539 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 4375..4389 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 4411..4425 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 4486..4500 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5149..5421 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5200..5214 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5239..5253 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 5317..5331 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 5359..5376 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 5398..5409 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 5839..6111 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 5890..5904 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 5929..5943 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6007..6021 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6049..6066 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6088..6099 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6235..6507 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6286..6303 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6328..6342 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6403..6417 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6445..6462 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6484..6495 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 6568..6855 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 6619..6633 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 6658..6672 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 6751..6765 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 6793..6810 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 6832..6843 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 7261..7449 /gene="Obscn" /note="Src homology 3 domain of Obscurin and similar proteins; Region: SH3_Obscurin_like; cd12025" /db_xref="CDD:212958" misc_feature order(7282..7284,7288..7290,7312..7317,7366..7374, 7423..7425,7429..7431,7435..7440) /gene="Obscn" /note="peptide ligand binding site [polypeptide binding]; other site" /db_xref="CDD:212958" misc_feature 7546..8076 /gene="Obscn" /note="Guanine nucleotide exchange factor for Rho/Rac/Cdc42-like GTPases; Also called Dbl-homologous (DH) domain. It appears that PH domains invariably occur C-terminal to RhoGEF/DH domains; Region: RhoGEF; cl02571" /db_xref="CDD:445839" misc_feature order(7555..7557,7567..7569,7933..7938,7945..7950, 7954..7959,7966..7971,7978..7983,7990..7992,8068..8070) /gene="Obscn" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:238091" misc_feature 8101..8475 /gene="Obscn" /note="Obscurin pleckstrin homology (PH) domain; Region: PH_Obscurin; cd13239" /db_xref="CDD:270059" misc_feature 8497..8769 /gene="Obscn" /note="First immunoglobulin-like domains A168 within the A-band segment of human cardiac titin, and similar domains; a member of the I-set of IgSF domains; Region: IgI_1_Titin-A168_like; cd20971" /db_xref="CDD:409563" misc_feature 8512..8532 /gene="Obscn" /note="Ig strand A' [structural motif]; Region: Ig strand A'" /db_xref="CDD:409563" misc_feature 8545..8571 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409563" misc_feature 8587..8604 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409563" misc_feature 8611..8619 /gene="Obscn" /note="Ig strand C' [structural motif]; Region: Ig strand C'" /db_xref="CDD:409563" misc_feature 8635..8658 /gene="Obscn" /note="Ig strand D [structural motif]; Region: Ig strand D" /db_xref="CDD:409563" misc_feature 8665..8685 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409563" misc_feature 8704..8730 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409563" misc_feature 8737..8769 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409563" misc_feature 8779..9048 /gene="Obscn" /note="Immunoglobulin domain; Region: Ig; cl11960" /db_xref="CDD:448366" misc_feature 8830..8844 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 8869..8883 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 8950..8964 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 8992..9009 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9031..9042 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9541..9810 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 9592..9606 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 9631..9645 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 9706..9720 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 9748..9765 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 9787..9798 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 9862..10632 /gene="Obscn" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(9889..9900,9907..9909,9913..9915,9952..9954, 9958..9960,10042..10044,10090..10101,10228..10230, 10240..10245,10249..10251,10285..10290) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" misc_feature 12781..13029 /gene="Obscn" /note="Immunoglobulin I-set domain; Region: I-set; pfam07679" /db_xref="CDD:400151" misc_feature 12832..12846 /gene="Obscn" /note="Ig strand B [structural motif]; Region: Ig strand B" /db_xref="CDD:409353" misc_feature 12871..12885 /gene="Obscn" /note="Ig strand C [structural motif]; Region: Ig strand C" /db_xref="CDD:409353" misc_feature 12946..12963 /gene="Obscn" /note="Ig strand E [structural motif]; Region: Ig strand E" /db_xref="CDD:409353" misc_feature 12991..13008 /gene="Obscn" /note="Ig strand F [structural motif]; Region: Ig strand F" /db_xref="CDD:409353" misc_feature 13033..13044 /gene="Obscn" /note="Ig strand G [structural motif]; Region: Ig strand G" /db_xref="CDD:409353" misc_feature 13063..13299 /gene="Obscn" /note="Fibronectin type 3 domain; Region: FN3; smart00060" /db_xref="CDD:214495" misc_feature 13399..14169 /gene="Obscn" /note="Protein Kinases, catalytic domain; Region: PKc_like; cl21453" /db_xref="CDD:451246" misc_feature order(13429..13440,13447..13449,13453..13455,13492..13494, 13498..13500,13582..13584,13630..13641,13768..13770, 13780..13785,13789..13791,13819..13824) /gene="Obscn" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:270870" ORIGIN
atgggggcagatacagcctgaggcaggatggggccttgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcgtgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgcccccccagattcacagaagacttgaaaagccaagaggccacagaaggcaccatggtaactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggcactgccccccaagttcacagagggtctgaaaaaggaagaggccacagaagggaacatggcgactctgaggtgccagatgagcaaggcggcccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgcgtgtgagctgcagatccgtggtctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcatagaagacttgagaagccaagaggccacagaagggaacatggtgactctaaggtgccagatgagcaaggtgacccctgtggagtggaggaaggggtcagagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtgtgagctgcagatccatcgcctggctctggaagatgctggggagtactcatgcctgtgtgggcaggagaagacgtcagccacactgagtgtcaaggccctgccccccagattcacagaagacttgagaagccaaaaagccacggaaggcaccatggtgactttaaggtgccagatgagcaaggcagcccctgtggagtggaggaaggggtctgagaccctgagagatgggggcagatacagcctgaggcaggatggggccgtgtatgagctgcagatccgaggcttggctctggaagatgctggggagtactcatgtgtgtgtgggcaggagaagacctcagccacactgagtgtcaaggcccttccagccagattcatagaagatttgagaagccaagaggtcccggaaagttcaacagtcacaatgcggtgtgagctaagcaagaaggcccctgtggtgtggaggaaagggtctgagaccctgaaaaatggggccaggtacagcctgagacaggatggtgctgtgtgtgagctggagatccgtgacctgactgtggaagatgctggagagtactcatgcacatgtgggaaggagaggacctcagccacactgagcattatggctccacaggtggtgttccagaagttactggagaatctgcaagcagaagaaggctccacagccagcctgcggtgtgagctgtcagtccccaacactgctgtggtctggagcaagggcggcctggagctgcaggctgacacatgccgagagacacggcagcagggctgcgttgcagaactgctgcttagggacgtgcgccgtgaggacgcgggcgagtacagctgtacctgtggttcccagaccacaagtgccacactcatggtcacagctgctcctgtgaggttcctccaggagctacaggcccaggacgtagatgaagggaccaccgcacgcctgcgctgtgagctgagccgggaggctgcgagtgtggaatggcgcaagggctccttgcagctttttccttgtgctaagtatcagatggtgcaggagggcacaactgcagagctgctagtccatggggtggagcaggaggatgcaggggaatacacctgcgatgcaggacacatgcagagcattgccaggctctccgtccgagcccccaagcccaagttcaagaccggcctacagagcaaagagcaagaagcaggtggcacagcacggctgtgttgtcaactgagcgaagctgagtcggggactccagtacaatggctcaaagagggggtggagctgcatgtcagctccaagtacgagatgcggtgccaaggggctatgtgtgagttgctgatccacaagctggaggccaaggacactggtgaatatgcctgcgtggtgggtggccagaagaccttggcctccctcagagtcaaagagcctgaggtgaccattgtgcagggactggtggacatggaggtgcaggctgatgaggatgtggagttcacttgcaaggtgtcacaggcaggagccacagatgtgcagtggcatctccaaggtctgccactgcagagcaatgaagtgacagaggtggctgttcttggagacggctgtacccatgtgctccagttgaagggtgtgacactggatgatgctggtactgtctccttccacgtgggcagccattcatcttctgctcagctcatagtccgagtccccgaggtgaccgttctggagcccctgaaggatgtgcagctcagcgagggccaggatgcccatttccagtgccggctgtccagggcttcgggccaggaggctcgctgggctttgggaggagttcccttgcagtgcaatgagatgaatgacatcactgtggagcagggcacactctactcgctcactctgcacaaggtgaccctcgaggatgccggaaccatcactctccaagtgggctcatgctcctcagaggcccagctgaaggtcacagaggcagcactgtgcctggtacgaggcttgcagaatgtggatgtcttcgcgggggaggtggccacgttctcctgtgaggtatctcgagcaggtgggccagaggcccgctggtggctggatggcaccctgcttcagaacagccctgagagtgccatgactgtacgagagggtactgttcactccctcacgctctcgggcctgggggtggctgactcaggcaccatcaccttccgcacggggcccctggtctccacagccaagttattggtcaaagatcccacagtggaggtggtgagtgccatgcaggacctggtggtggaggagggtggctcggccgagctcctctgccagtactcgcggcccgtgcaggccatgtggaagatgaacgagcgggaggtgtgcgcggatgggcaccgtgtcatcatagagcaggactggaccgtagccaggctgaccctcaggccggccctgccctgtgacagtggcatctattcttgtgaggctgcgggcactcgagttgtggcactgctccaagtgcaagccaagaacacagtggtgcgtggcctggagaatgtggatgcactggagggcggcgaagctctgttcgagtgtcagctgtcccagccggaagtggctgcccacacctggttactagacgatgagcctgtgcacacatcagcaaacgtggaggtggtctactttgagaacggactgcgccacttgcttttgctcaaaaacctgaagccacaggacagctgccgagtgaccttcctggcaggggacgtggtcacgtctgccttcctcactgtgagaggctggcgcttggaggtcctggagcccccacaagacgcatctgtgaaagctggtacgcaggtctgcttcacttgcatactaagtgaggccctgcctgtgggcgaggctacttggtacatcaacggggctgccatccaacctgatgacgctgactggatagtcaccgcagatggcagccaccatgccctgacgctgagcaacgcccagccccagcacgcaggagaggtcacatttgcagcacgtgacgccgtggcctctgcacgcctctctgtgttggctctccctggtccccctgaagatgctgaagtagtgggtcgaagtgaccactctgtgaccctatcctgggtggctcccgtgagtgacggcggcggcggtctatgtggttatcgtgtggagatgaaggaggcatccacaggccagtggcagttgtgccatgagttggtacctggcccagagtgtgtggtggacggcctggtctctgggaagacctaccgcttccgagtggcagccgtgggtccggcaggagctggggagcctgtacatctgccccagatggtcaagatagcagagccaatggaacctaaaccagccccagccccagcccctgccctagccccaaccccagctccaatcccaaccccagccccagccccagccccagccccaaccccagccccaaccccaaccccagccccagccccagcccctgccccagccccagcaacacggcgagcagtggttggtgaagatgtgtgtctggagctggaagtggcagctgatgctggcgaggtcgtctggcacaagggaacagagcgcatccatcccagtgggcactttgaggtcctctctcagggtcagcggcagatgctggtgatcaagggctttaggaccgaagaccagggggagtaccgctgtggtcccatccagggcctgccctcctcaggagcttctactttcaatgtggtcgtgacctcgggctcggaggatgaggtccctgcacagcccagcctgcctcccgaggcagcccaggagggtgacctgcatctgctttgggaggcccttgctcggaagcgtcgcatgagccgggagcccacgctggactccatcagtgagctgcccgaggaagacagccgtgtgcagcatctgcggcaggaggcagaagaggcggctcctgacctctctgagggctactccacagccgatgagctcgcacgcacaggagaagctgacctctcacacaccagctctgatgacgagtctcgggctggcaccccttccctaattacctacctcaagaaggccgggggtcctgggatctcacccttggccagcaagcatgaggcccaggtggccacgtctgtgaagccacaaaagcagcaggagcgggttgtgcccacatgcccactgccgggagatttgaacgcagcagatttgaaggatccatccctggacaaggccgctgtgaagatccaggctgcctttaagggctacaaagtgaggaaggagatgaagcagcagggaggccccgtgttctcacggacatttggggacacagaggcacaggttggggatgcgctgcggctggagtgtgtggtgtccaccaaggctgacgtgcgggcctgctggttgaaggatggcgtagagttaacagatgggcgccattaccacatagaccagctcaaggacggtacctgctctctgctggtcactggcctgggccccactgactctggtcgctacacctgtcaggtgagcaccaagtttggaagcgtgagccacagtgcctgcgtaatggtcagtgggacagaaagtgaggctgagagctcctcaggaggtgagctggacgatgccttccgccgggcagcacgacgcctgcatcgtctcttccgaaccaagagcccagctgagctttcagaagaggagctcttcctcagtgctgacgaaggccccatggagccagaggagcctgcagactggcaaacataccgagaggatgaaaactttgtgtgcatccgttttgagtcacttgcagaggcccaccgggcagtcacctgcttccgtgacatgtttgccaccatgggcatcggggtggagatcagcctaggggagcaggggccccggggagtggagatgcgcattggcaaggtggcccccactgtcatccctgcggtgccacttgcaaagacacctggcctgcagacttcagatgctgccccagtgttcctgacggagctgcagaaccaagacgtgcaggacggataccccatgagcttcgactgcgtggtaacaggccagcctgtgcccagtgtgcgctggttcaaggacgggaagttgctagaagaggatgaccactacatgatcaacgaggaccaacaggggggtcaccagctcatcatcacagccgtggtgccggcagacatgggagtgtaccgctgcctggcggagaacagcatgggcgtctcctccaccaaggctgagcttcgtgtggaattgaccagcacagactatgacactgctgctgatgctaccgagacctcatcctacttcagcgcccagggatacctgtccagccgggagcaagaggggacggagtcagatgaggggcagcttccccaggtgctggaggaactgaaagacctccaggtggcccctggcacacgcctggccaagttccagctcaaggtgaaaggttatccagctcccaaactgtactggttcaaagatggccagcccctgaccacatctgaccacatccgcatgactgacaaaaagaccctgcacaccctggagattgtctccatcacccgagaggacagcggccagtacgcggcctacatcagcaatgctgtgggtgccgcctattcgtcagcccggctgctggtccgaggtcccagtgaaccagaagagaagccacaaccagatgttcatgagaggctggtgccaccccgaatcctggagaagttcacccccaagaaagtgaagaggggctccagcatcaccttttcagtgaaggtggaaggacacccggcccccagtgtgcattggctcaaggaggaggcagagaagggagtcctgtggattggccctgatacccctggctacacgatggccagttcttccaagcaacatagcctggtcctgctggacgtaggccgacagcaccagggcacctacacgtgcattgccaccaatgctgctggccaggcgctctgctctgccagtctgcacatctctggcttggccaaagaagaggagcaggagagagtgaaggaggctctcatttcctccttcctgcaagggacgagccaagctgtctcagcccagatgtcagaatctgcaagttttgctgatcttgtcgggcaaaggaaaggtgagtccctggtggctgaggaggcccacagtcacctgtccctttctgaggtgggcacagaagagttcctgcagaaactcacctcacagatcaccgagatggtatcagccaagatctcgcaggccaaactccaggtgcctggaggtgacagtgatgaggagtctaagacaccatctgcttctcctcggcacggccggtcacgtccttcctccagtgttcaagagtcttcctcagagtcagaggatggagactcccgtggtgagatctttgacatctacgtggtcacagctgattatctgcccctgggagctgagcaggatgccatcatcctgagagaaggccagtatgtggaggtcctggactcagcccatcccctgcgctggcttgtacgcaccaagcccaccaaatccagcccttccaggcagggctgggtgtcacctgcctacctggacaagaggctcaagctatctcctgagtgggggcccactgaggcccctgagttccctggcgaggctgtgtctgaggatgagtatagaacgaggctgagctctgtcatccaggagttgctgagttcagagcaggcttttgtgggtgagttacagttcttggagagccaccacatcaagcacctggaccgatctccccgtgtacccgcagctgtggccagccagaagacggtcatctttcgtaatgtgcaggacatcagccatttccacagcagcttcttgaaggagctgcagagctgtggcaccgacgatgatgtagccatgtgcttcatcaagaaccaggaggcctttgagaagtaccttgagttcctggtgggccgggtgcaagcggaatcagtggtcgtcagcaccccagtccaggagttctacaagaaatatgcagaagagatgctgtcagccaaggaccccacacagccacccccacctcctcttcagcactacttggagcagccagtggaacgggtgcagaaataccaggccttgctgaaggagctaatccgcaacaaggctcgcaaccggcagaactgtgcgctgctggagcaggcctacgctgtggtgtctgccctgcctcagcgtgctgagaacaagctgcacgtttctctcatggagaactacccgggaaccctggaggccctgggagaacctatccgccagggtcacttcatagtgtgggagggggctccaggagcccggatgccttggaagggccacaaccggcatgtcttcctcttccgaaaccacctggtgatctgcaagccccggagagactctcgaacggacaccttcagctacgtgttccggaacatgatgaagctgaatagcatcgacctgaatgaccaggtagagggggatgaccgtgcctttgaggtgtggcacgagcgggaagactctgtccgcaagtacctgctgcaggcgcggacagtgatcatcaaaaactcatgggtgaaggagatctgtggcatccagcagcgccttgcccagcccgtgtggcgtccccctgagtttgaagaagaactagctgactgcacagccgagctgggtgaaacagtcaagctagcatgccgagtgactggcacacctaagcctattgtcagctggtacaaagatgggaagcccgtggaggtggacccacaccacatcctcattgaagaccctgatggctcctgtaccctcatcttggacaaccttactggcatagactctggccagtacatgtgttttgcggccagtgctgctggcaatgccagcaccttggggaagattctagtacaagtgcccccacgatttgtgaacaaggtccgagccacaccctttgtggagggagaggacgcgcagatcacctgcacagtggaaggagctccgtaccctcagatcaggtggtacaaggacggtgccctgctaaccctgggcaacaggtaccggatggtgaatgagccccgcagtggtatgctggtgctggtgatccaggcagccagcaaggaggacctgggacactatgaatgtgagttggtgaaccggttgggctcaacacgttgtggcggagaattatacatgcagagtcccgcactgcgtgcctgggaccagcaccaccgggaacagcttgtggctgctgtggaagacgcctccatggaggactctgcccaccccactcaggagggagctgaccaacaagccgcttctgtcctttggaggctgctgggctcagaagccctcagcccctccccagggggtttccccaacaccagacaaagtgagccacccacatcagaagaggctgctccccagatcccaggcacaacttcaggaacacctggcaaactcccagaggcttcacggcccggcacatacaaaggcctggagcaggggatgacaacaacttctggatcccaggaacggaatgtacccattcgggtggagggcacggcctggccaggcggaggcactgggcagctgctcttggatgtgcacagccaagtcatcatggagaccacacagaggacctatgtgtgccaagctcctgacacaggtgtcacaagggccccatccatgcaggtcactatcgaggacctacaagtacaagtgggtgacatggcacagtttgatgctgtcattgaaggcaacccaccgccaacagtgacctggtacaaggacagcaaccagctggtgaacggtacccggctgaggcagcagcaaggtggaactacatattccttggtgttgatggacgtgactccacacgatgccggtgtctacacctgtgttgcccagaatgcaggtggacaggtgctgtgcaaggcagagctgctggtctatgggggggacaagtcagatgctgaaaagcaagcctatcggaggaaactgcattccttctatgaagttcaagaagagattgggaggggtgtgtttggttttgtgaaaagagttcagcataaaggaaacaagatgtcctgtgctgccaagttcatccccctgcggagcaaaactcgggcccaggcataccaggaacgagacatcttggctaccctcagccacccactggtcactgggctcctggatcaatttgagacccagaagactctcatccttatcttggaactgtgctcatccgaggagctgctggatcgcctcttcaagaaggctgtagtgaccgaagctgaggtcaaggtctatatccagcagctggtggaaggcctacactacctgcacagccatgatatcctccatctggacataaagccccccaacatcctgatggtccacccagctcgggaagacattaagatctgtgactttggctttgcccaaaagatcaccccgtcagagccacagtacagcaagtatggctcacctgaattcgtgtccccagagatcatcgagcagagtcctgtgagtgagggctcagacatctgggccatgggcgtcatctcctacctcagcctcacctgttcatccccattcgctggagagagtgaccgtgccaccctgctcaatgttttggaggggcgggtctcttggagcagtcccatggctgcccatctgagtgaggatgccaaggacttcatcaaggccacactgcaaaagacccccagggcccggcctagtgcttcccagtgccttgctcacccctggttcctgaagtccatgcctgctgaggaggcccacttcatcaacaccaaacagctcaagttccttcttgctcgcagtcgctggcagcgttccttgatgagctacaagtctatcctggtgatgcgctccatccctgagctgctccagggtcctccagacagtccatctctaggagtggcccggcacctacgaggggaagccagcggatcctctagctcatcgtcttcctcggacaatgagcttgccccatttgccagggctaagtcactgccaccttcccctgtcactcactcgccactgctgcaccctcggggctttctgcggccttcagccagcctcccggaggagacagaggccagcatgtccactgctgatgcagccatgccggcacccccccagagtgctgggcctccagcaagcccaggttgtgtgccccggcacagcgtcatcagcagcttgttctaccagcaagctggtgagggtgcagagcgtgggagcaaagcgttgggcgccaagaggcacccagctcggagacgccacctgctaaagggcgggtacattgcaagggccctgcccgggctacgagagccgctgatggagtttagtgtgttggaggaagaggctgctaatgaggagcaggcctctctgatgaccaagacaccctcctttgagaccgctctgcgactacctagttccaatgtcagagaggtcccaggccgaagccgctccctggacaacccaccaggcacagccagcccctctcctgaggcatacaaggaacaatacctgtccccaccctcctcggggttgactcatgaaaccaccgccaagggcatgggacacaaagaagggttcttgcaggagtctgtccccttttcacctaccagtggtgacctgaggcctgttaagcaagaggggtcatcccaggatagctgtagagggaaaccagcctcttcctgtcactctgaactgggttctggtccgcaggagggctgtggctctccatcatcacaattgtgtggctccttacctccacagtcatcgaagaaagagctctcaaaaccctgtggcccactcttttcagaacagcctcaggcagccccattcccagcgcaagcaagcccccttctgggttctcagaaggaacctcaggatagctatctacctgaaaagccatgtccagttccctccagttctccagggtcagcctcccaagtagatgcatccctggataccgaaggcttgtcggaagctggggacacatgtgacttcacgcctcctctccagcggcctcaggagcaggccaccacccggaagttctctctggaatcccgtgggggctatgcaggggtggcaggatatggcaccttcgcctttggtggggatgcaggggggatgttagggcagggtcccctttgggccaggatggcctgggctgtgtcccagtcctcagaagagcaagatgaagcagcgactgagagccctcaacctctggacagctcagggcccattgctgaggccagtggggttcccctaaggacctcgccaagcctcaccccatgggaggaagttgagcaggtttccctggtacagatccgggatctgtctggtgatgcagaagcagccgacaccatctccttggacatttcagaggtagatcctgcctacctcaacctctccgatctatatgacatcaagtatctcccgtttgagttcatgatcttcaggagggtccccaaacctgtagagcagccagagtcacctggctctgaaactgaagaggggcaagggctggcggagttcctggaggaggctgtgtggccctggccaggcgagctgggactgcgtgctggtctggagattacagaggagccacaggagccaggggacctggaagcactgctgggcgaggctgctgtgggcaggaagcgcaagtggtccccctcccgtggcctcttccaattccctgggaggtgcctgtcaggggaggagcccgtggagcttgggctgcgccagagggtgaaggcttccatggctcacatctccaggatcctgaagggcaagccggaaggtcctgagaaggaagggcctcccagaaagaaggcaggcctagcttctttccggctatcaggcctgaagggcagggaccaagcgccatccttcctaagagaactctctgatgaggctgtggtcctgggccaatcagtgacactggcctgccaggtgttggcccagccaactgcccaggctacctggagcaaagatggggcccttctggagagcagcggccacctcctcatctcttccaccctgaagaacttccagctgctgaccattctggtggtgacggaggaggatctgggcacatatacctgctgtgtgagcaacccactagggacagcagtcaccacaggtgtcctccggaaagcagagcgcccttcatcttctccacgcccggaggtgggggaactatacacggatgcagtgttgctggtctggaagcctgtggaatcctatggcccagtgacctacattgtgcagtgctgtatagaaggaggcagctggacaaccctggcctctgacatctccgactgctgctacctcactggcaagctgccccggggtggcatgtataccttccggacagcatgtgtcagcaaagcaggaatgggcccctacagtagcccctcagaacaggtcctccttggaggacccaaccacctggcttctgaggaggaaagcagccgggggagaccagcccagcttcttcccagcacaaagacttttgccttccagacacagatccggaggggccgcttcagtgtggtgaggcagtgtagggagaaagcaagtgggcgggccctggctgctaagatcgttccctaccagcctgaggacaagacaactgtactaagagaatatgaggcactaaagagactgcaccacccacatctggcccaactccatgctgcctacctcagtccccggcacctggtgctcatcctagagctgtgctctggccctgagctgctaccctctctggcggagagggactcgtactcagagtctgatgtgaaggactacctgtggcagatgctcagtgccacccagtacctgcatgcccaacacatcctgcacctggacctgaggtcggagaacatgatggtcaccgagtacaacctgcttaaggttatagacctgggtaacgcccagagtctcagccaagagaaggtcccacctcctgaaaacttcaaagactacctagagaccatggctccagaacttctggaaggccaaggggcggttccacagacagacatctgggctattggtgtaacagccttcattatgctgagtggcgagtacccagtgagcagcgaggggactcgcgacctgcagaaaggcctgcgcaagggactcattcaattgagtcgctgctatgcaggattatcagggggtgcggtagccttcctgcagagttcattgtgcgctcggccctggggtcgcccgtgcgcttccacctgcttgcagtgcgggtggctgacggaggagggccccaccggttcccggcccacgcccgtgaccttccccaccgcgcgattgcgtgcctttgtgcgcgagcgcgagaagcgccgggcgctactctacaagaagcacaacctggctcaggtgcgctgaggcccagccctacagagcaagatgtgcccgccaataaaagatgcaaaacagcca
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]