2024-05-03 17:54:40, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_039080635 2790 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus splicing factor 1 (Sf1), transcript variant X12, mRNA. ACCESSION XM_039080635 VERSION XM_039080635.1 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051336.1) annotated using gene prediction method: Gnomon, supported by mRNA and EST evidence. Also see: Documentation of NCBI's Annotation Process ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..2790 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="1" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..2790 /gene="Sf1" /gene_synonym="Zfp162" /note="splicing factor 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 2 mRNAs, 51 ESTs, 3 long SRA reads, 2 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 205 samples with support for all annotated introns" /db_xref="GeneID:117855" /db_xref="RGD:620645" CDS 455..2023 /gene="Sf1" /gene_synonym="Zfp162" /codon_start=1 /product="splicing factor 1 isoform X12" /protein_id="XP_038936563.1" /db_xref="GeneID:117855" /db_xref="RGD:620645" /translation="
MEPRHNGTEDSDSRHAYGYPPWPDSGTRKSLYRSPSPEPIYNSEGKRLNTREFRTRKKLEEERHTLITEMVALNPDFKPPADYKPPATRVSDKVMIPQDEYPEINFVGLLIGPRGNTLKNIEKECNAKIMIRGKGSVKEGKVGRKDGQMLPGEDEPLHALVTANTMENVKKAVEQIRNILKQGIETPEDQNDLRKMQLRELARLNGTLREDDNRILRPWQSSETRSITNTTVCTKCGGAGHIASDCKFQRPGDPQSAQDKARMDKEYLSLMAELGEAPVPASVGSTSGPATTPLASAPRPAAPASNPPPPSLMSTTQSRPPWMNSGPSENRPYHGMHGGGPGGPGGGPHSFPHPLPSLTGGHGGHPMQHNPNGPPPPWMQPPPPPMNQGPHPPGHHGPPPMVPGKYACGLWGLSPASRKRYDAAAAYGHDAAASATSQWAAPASSLWSSSSMAAAAAAASTTPSAQQQYGFQHPLAMAAKIPPRSSDGPSHESEDFPRPLVTLPGRQPQQRPWWTGWFGKAA"
misc_feature <521..1087 /gene="Sf1" /gene_synonym="Zfp162" /note="Splicing factor (branch point binding protein) [RNA processing and modification]; Region: MSL5; COG5176" /db_xref="CDD:227503" misc_feature 719..997 /gene="Sf1" /gene_synonym="Zfp162" /note="type I K homology (KH) RNA-binding domain found in splicing factor 1 (SF1) and similar proteins; Region: KH-I_SF1; cd22382" /db_xref="CDD:411810" misc_feature order(764..769,773..781,785..799,806..808,839..853, 860..868,875..877) /gene="Sf1" /gene_synonym="Zfp162" /note="RNA binding site [nucleotide binding]; other site" /db_xref="CDD:411810" misc_feature 1148..1195 /gene="Sf1" /gene_synonym="Zfp162" /note="zinc finger; Region: ZnF_C2HC; smart00343" /db_xref="CDD:197667" ORIGIN
tcagtccgcgcagtaacaagaagtgcgcgctgcgacacctcccagttcactcggccccgccgccatttcgtcgcctggcctaacggttcggccaatcccgacgcgtattgaaaagaactagtgctccgccaatcggaggccgctgactccgacctcacctcgggccggcccaatccaggccgcggccccgccgcccccaacccgcccccgcggcgtcctctctcctccctctttgtgcgtctggcgccgccgccgcccgccgcgtgagaggacgggctccccgcgctcttcgggagcgtagtcgggtcccctccccccaacccgcgaaggttcgtgaaggagaagccgccgcggaggacgaggaaccgctggtgccggtcccctggggcgccatggcgaccggagcgaacgccacgccgctggacttcccaagtaagaagaggaagaggagccgatggaaccaagacacaatggaacagaagacagtgattccaggcatgcctacggttatcccccctggcctgactcgggaacaagaaagagcttatataggtccccttcccctgagccaatctacaacagcgaggggaagcggcttaatactcgagaattccgtacccgaaaaaagcttgaagaggagcggcataccctcattacggagatggttgctctcaacccagactttaaaccacctgcagattacaagcctccagcaacacgtgtgagcgataaagtaatgatcccccaagacgagtatccagaaatcaattttgtggggctcctaattgggcccagagggaacaccctgaagaacattgagaaggaatgcaacgccaagatcatgatacggggaaagggatcagtaaaagaagggaaagttgggcgtaaagatggtcagatgttgccaggagaagatgaacctcttcatgctctagtcactgccaatacaatggagaatgtcaaaaaggcagtggaacagatcagaaacatcctgaagcagggtattgaaaccccagaggaccagaatgacctaaggaaaatgcagcttcgagagttagctcgcttgaatggcactctacgggaagatgataacaggatcttgagaccctggcagagctcagagacacgaagcattaccaacacgactgtgtgtactaagtgtggaggggctggtcacattgcctctgattgcaaatttcagaggcctggtgaccctcaatcagctcaggataaagcacggatggataaagagtatttgtcccttatggctgagctaggggaagctcctgtccctgcatctgtgggctccacctctggacctgccaccacacccctggccagtgcaccaaggcctgctgctcctgccagcaacccaccaccaccgtctctcatgtctacaactcagagtcgcccaccctggatgaattctggtccttcagagaatcggccctaccatggcatgcatggaggtggtcctggtgggcctggaggtggcccccacagtttcccacacccattacccagcctgacaggtgggcatggtggacatcccatgcagcacaacccaaatggaccaccaccaccttggatgcagccaccaccaccaccgatgaaccagggcccccacccacctgggcaccatggccctcctccaatggtacctgggaagtacgcctgtgggctctggggtctatcgcctgcatcaaggaaaaggtatgatgccgccgccgcctatgggcatgatgccgccgcctccgccacctcccagtgggcagcccccgcctcctccctctggtcctcttcctccatggcagcagcagcagcagcagcctccaccaccccctccgcccagcagcagtatggcttccagcacccccttgccatggcagcaaagatccctccccgcagcagcgatggcccgagccatgagagtgaggactttccgcgcccattggtgacccttccaggcagacagcctcaacagcgcccctggtggacaggatggttcggcaaagcagcctgagttatttttgtggacggaatcggaacacgctggctccatatcgtgaaatttttattaatttttatctttttcctttgttatttccttatcttttcctttcttcagactccgtccaaggagatgctctccccgatcttctgctgcagataggatccttccccttgtctccattcctttcctcccataggggagaggggcaaatggtttaggcacaggctttggctagtaatgtcaggcgtggtggtggcggcggggtcctattgttctaatttgttgaagggcctcaaccacactcaaagaagggtggtttatcttcgacatcttaaagagtcttgataatcctgacattgctaaataggggtaatccggcagtgggattcattcatatcttcctgcactcctgccagcagtacatggcacagcccaagccaccctaggccagcctggagtcttttccatgctctgatcacctaagctgcctcagaactcatttgcttctctccttcctggaaagcttccctttatgttttattttgaccccagatgtccagatgttttgcagtgtctggggcttgtgccccttgttgttcgttctgcttctttgcccctttcctctacatggagtgattatgttgacaataatgtgtaatgcgcgttcttttcactggtttatctacagaaatttctctgggccttttttctgtgtttgattcaacactgcactaagcggggaatgttccaattaataaaagagcagtgtggttttc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]