2024-04-29 17:51:44, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017601562 3108 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X9, mRNA. ACCESSION XM_017601562 VERSION XM_017601562.2 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051355.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jan 21, 2021 this sequence version replaced XM_017601562.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3108 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="20" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..3108 /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="discoidin domain receptor tyrosine kinase 1; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 44 ESTs, 7 long SRA reads, 5 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 128 samples with support for all annotated introns" /db_xref="GeneID:25678" /db_xref="RGD:2252" CDS 67..2322 /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /codon_start=1 /product="epithelial discoidin domain-containing receptor 1 isoform X3" /protein_id="XP_017457051.1" /db_xref="GeneID:25678" /db_xref="RGD:2252" /translation="
MVARLVRFYPRADRVMSVCLRVELYGCLWRDGLLSYTAPVGQTMQLSEMVYLNDSTYDGYTAGGLQYGGLGQLADGVVGLDDFRQSQELRVWPGYDYVGWSNHSFPSGYVEMEFEFDRLRSFQTMQVHCNNMHTLGARLPGGVECRFKRGPAMAWEGEPVRHALGGSLGDPRARAISVPLGGHVGRFLQCRFLFAGPWLLFSEISFISDVVNDSSDTFPPAPWWPPGPPPTNFSSLELEPRGQQPVAKAEGSPTAILIGCLVAIILLLLLIIALMLWRLHWRRLLSKAERRVLEEELTVHLSVPGDTILINNRPGPREPPPYQEPRPRGTPTHSAPCVPNGSALLLSNPAYRLLLATYARPPRGPGPPTPAWAKPTNTQACSGDYMEPEKPGAPLLPPPPQNSVPHYAEADIVTLQGVTGGNTYAVPALPPGAVGDGPPRVDFPRSRLRFKEKLGEGQFGEVHLCEVEDPQDLVTSDFPISVQKGHPLLVAVKILRPDATKNARNDFLKEVKIMSRLKDPNIIRLLGVCVQDDPLCMITDYMENGDLNQFLSAHQLENKVTQGLPGDRESDQGPTISYPMLLHVGAQIASGMRYLATLNFVHRDLATRNCLVGENFTIKIADFGMSRNLYAGDYYRVQGRAVLPIRWMAWECILMGKFTTASDVWAFGVTLWEVLMLCRSQPFGQLTDEQVIENAGEFFRDQGRQVYLSRPPACPQTLYELMLRCWSREPEQRPPFSQLHRFLADDALNTV"
misc_feature <67..147 /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="Coagulation factor 5/8 C-terminal domain, discoidin domain; Cell surface-attached carbohydrate-binding domain, present in eukaryotes and assumed to have horizontally transferred to eubacterial genomes; Region: FA58C; cl25480" /db_xref="CDD:330301" misc_feature 1390..2301 /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="Catalytic domain of the Protein Tyrosine Kinase, Discoidin Domain Receptor 1; Region: PTKc_DDR1; cd05096" /db_xref="CDD:133227" misc_feature order(1426..1440,1450..1452,1537..1539,1543..1545, 1681..1692,1699..1704,1876..1878,1888..1893,1897..1899, 1930..1932,1984..1998,2023..2025,2128..2130) /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="active site" /db_xref="CDD:133227" misc_feature order(1426..1431,1435..1440,1450..1452,1537..1539, 1543..1545,1681..1692,1699..1704,1888..1893,1897..1899, 1930..1932) /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:133227" misc_feature order(1876..1878,1888..1890,1984..1998,2023..2025, 2128..2130) /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="polypeptide substrate binding site [polypeptide binding]; other site" /db_xref="CDD:133227" misc_feature 1927..2004 /gene="Ddr1" /gene_synonym="Cak; Drd1; PTK3D" /note="activation loop (A-loop); other site" /db_xref="CDD:133227" ORIGIN
ggtcagggggtgatttcgggtaacgaggatcctgggggagtggtgctgaaggatctcgggccccccatggtggcccggctggtccgtttctaccccagggctgaccgggtcatgagtgtctgtcttcgggtggagctctatggctgcctctggcgggacggactcttgtcctatacagcccccgtggggcagaccatgcaattatctgagatggtgtatctcaatgattccacttacgatggatatactgctggagggctgcagtacggtggtctgggccaactggcagacggcgtggtggggctggatgatttcaggcagagccaggagctgcgggtttggccaggctatgactatgtgggatggagcaaccatagcttccccagcggctacgtggagatggagtttgagtttgaccggctgaggtctttccagaccatgcaggtccactgtaacaacatgcacactctgggagcccgcctcccaggcggggtggaatgccggtttaaaaggggtccggccatggcctgggaaggagagcctgtacgccatgccctggggggtagccttggagaccccagagccagggccatctcggtgcccctgggtggtcacgtgggccgcttcctgcagtgcagattcctctttgcaggaccctggttactcttcagtgagatctctttcatctcggatgtggtgaacgactcgtctgacaccttcccaccagccccctggtggccgcctggcccgcctcccaccaacttcagcagcttggagctggagccccggggtcaacagcctgtggccaaggcggaggggagcccaactgccatcctcattggctgcctggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttggggaggtacatctctgtgaagtagaggaccctcaagatctggtcactagtgacttccctatcagtgtgcaaaagggacaccccttgctggtggcagtgaagatcctccggccagatgccaccaaaaatgccaggaatgacttcctgaaggaggtaaagatcatgtcacggctgaaggacccaaacatcatccggctcctgggtgtgtgtgtgcaggatgaccctctctgcatgattacagactacatggagaacggtgacctgaaccaattcctcagtgcccaccagctggagaacaaggtcactcaggggcttcctggggacagagagtctgaccaggggcccacaatcagctaccctatgctgttacacgtgggggcccagatcgcctctggcatgcgatatctggccacccttaactttgtgcatcgggacctggccacccggaactgcttggttggggaaaatttcaccatcaaaatcgccgactttggcatgagccggaatctctacgctggggattattaccgtgtacagggccgggcagtgctgcccatcaggtggatggcctgggagtgtatcctcatggggaagttcacaacagccagtgatgtgtgggccttcggagtgaccctgtgggaggtgcttatgctctgcaggtcacagcccttcgggcaactcacagacgagcaggtcatcgagaacgccggcgagttcttcagggaccagggccggcaggtatacttatccaggccacccgcctgcccgcagaccttgtatgagctgatgctccggtgttggagccgggagccggagcagcggccgcccttctcccagcttcatcggttcctggcggatgatgcactcaacacagtgtaaactaaggacctggcagccctttttcactgggagccatccaggggaagctggacactaaaaccagagaagcctatggcaccccgcccaccatctccccgacttgcccattcccaagaggcagtgtctctgcaggtgggctgggcccgcccagggaaccgaagactctgttaccagatacgtgctcccttcctgttcttcctcccacctgccaagctccacccacccagctggccctgtggttgggatcctgcctgacttcttccagctatcccctagggaaagacaggggcgaatgctgggcacacactggacaaggcccactggacaacactggttcctgggaggtgacggtaccccccagcttcttcttgtcacacactggacaccgccagaattgagggggacgagggggacaaggaaggccaaccctctacaatggtcctcagccctggcttccttctgcaccctccgcctctgacacactggacctgggggtgacccctgctgtgatcctcagtcaaacacccctccttcctacctaccaccatgttgccgctagaacttccgcaaagcctctgcgttcctgtggagtaaatattaggatggggaacagatggagcagtagcccgaggccggggggtggggatttctcttgtagctaccacattggtttttctataatcacgtggggtttgtacattttttggggggagagacacagatttttacactaatatatggacctagctcgaggcagttttaatctcctgctctaggcaggtaata
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]