GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-04 12:21:42, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_017601562            3108 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine
            kinase 1 (Ddr1), transcript variant X9, mRNA.
ACCESSION   XM_017601562
VERSION     XM_017601562.2
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051355.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_017601562.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3108
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="20"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3108
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="discoidin domain receptor tyrosine kinase 1;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 44 ESTs, 7 long SRA reads, 5 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 128 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
     CDS             67..2322
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /codon_start=1
                     /product="epithelial discoidin domain-containing receptor
                     1 isoform X3"
                     /protein_id="XP_017457051.1"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
                     /translation="
MVARLVRFYPRADRVMSVCLRVELYGCLWRDGLLSYTAPVGQTMQLSEMVYLNDSTYDGYTAGGLQYGGLGQLADGVVGLDDFRQSQELRVWPGYDYVGWSNHSFPSGYVEMEFEFDRLRSFQTMQVHCNNMHTLGARLPGGVECRFKRGPAMAWEGEPVRHALGGSLGDPRARAISVPLGGHVGRFLQCRFLFAGPWLLFSEISFISDVVNDSSDTFPPAPWWPPGPPPTNFSSLELEPRGQQPVAKAEGSPTAILIGCLVAIILLLLLIIALMLWRLHWRRLLSKAERRVLEEELTVHLSVPGDTILINNRPGPREPPPYQEPRPRGTPTHSAPCVPNGSALLLSNPAYRLLLATYARPPRGPGPPTPAWAKPTNTQACSGDYMEPEKPGAPLLPPPPQNSVPHYAEADIVTLQGVTGGNTYAVPALPPGAVGDGPPRVDFPRSRLRFKEKLGEGQFGEVHLCEVEDPQDLVTSDFPISVQKGHPLLVAVKILRPDATKNARNDFLKEVKIMSRLKDPNIIRLLGVCVQDDPLCMITDYMENGDLNQFLSAHQLENKVTQGLPGDRESDQGPTISYPMLLHVGAQIASGMRYLATLNFVHRDLATRNCLVGENFTIKIADFGMSRNLYAGDYYRVQGRAVLPIRWMAWECILMGKFTTASDVWAFGVTLWEVLMLCRSQPFGQLTDEQVIENAGEFFRDQGRQVYLSRPPACPQTLYELMLRCWSREPEQRPPFSQLHRFLADDALNTV"
     misc_feature    <67..147
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Coagulation factor 5/8 C-terminal domain, discoidin
                     domain; Cell surface-attached carbohydrate-binding domain,
                     present in eukaryotes and assumed to have horizontally
                     transferred to eubacterial genomes; Region: FA58C;
                     cl25480"
                     /db_xref="CDD:330301"
     misc_feature    1390..2301
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Catalytic domain of the Protein Tyrosine Kinase,
                     Discoidin Domain Receptor 1; Region: PTKc_DDR1; cd05096"
                     /db_xref="CDD:133227"
     misc_feature    order(1426..1440,1450..1452,1537..1539,1543..1545,
                     1681..1692,1699..1704,1876..1878,1888..1893,1897..1899,
                     1930..1932,1984..1998,2023..2025,2128..2130)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="active site"
                     /db_xref="CDD:133227"
     misc_feature    order(1426..1431,1435..1440,1450..1452,1537..1539,
                     1543..1545,1681..1692,1699..1704,1888..1893,1897..1899,
                     1930..1932)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    order(1876..1878,1888..1890,1984..1998,2023..2025,
                     2128..2130)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    1927..2004
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:133227"
ORIGIN      
ggtcagggggtgatttcgggtaacgaggatcctgggggagtggtgctgaaggatctcgggccccccatggtggcccggctggtccgtttctaccccagggctgaccgggtcatgagtgtctgtcttcgggtggagctctatggctgcctctggcgggacggactcttgtcctatacagcccccgtggggcagaccatgcaattatctgagatggtgtatctcaatgattccacttacgatggatatactgctggagggctgcagtacggtggtctgggccaactggcagacggcgtggtggggctggatgatttcaggcagagccaggagctgcgggtttggccaggctatgactatgtgggatggagcaaccatagcttccccagcggctacgtggagatggagtttgagtttgaccggctgaggtctttccagaccatgcaggtccactgtaacaacatgcacactctgggagcccgcctcccaggcggggtggaatgccggtttaaaaggggtccggccatggcctgggaaggagagcctgtacgccatgccctggggggtagccttggagaccccagagccagggccatctcggtgcccctgggtggtcacgtgggccgcttcctgcagtgcagattcctctttgcaggaccctggttactcttcagtgagatctctttcatctcggatgtggtgaacgactcgtctgacaccttcccaccagccccctggtggccgcctggcccgcctcccaccaacttcagcagcttggagctggagccccggggtcaacagcctgtggccaaggcggaggggagcccaactgccatcctcattggctgcctggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttggggaggtacatctctgtgaagtagaggaccctcaagatctggtcactagtgacttccctatcagtgtgcaaaagggacaccccttgctggtggcagtgaagatcctccggccagatgccaccaaaaatgccaggaatgacttcctgaaggaggtaaagatcatgtcacggctgaaggacccaaacatcatccggctcctgggtgtgtgtgtgcaggatgaccctctctgcatgattacagactacatggagaacggtgacctgaaccaattcctcagtgcccaccagctggagaacaaggtcactcaggggcttcctggggacagagagtctgaccaggggcccacaatcagctaccctatgctgttacacgtgggggcccagatcgcctctggcatgcgatatctggccacccttaactttgtgcatcgggacctggccacccggaactgcttggttggggaaaatttcaccatcaaaatcgccgactttggcatgagccggaatctctacgctggggattattaccgtgtacagggccgggcagtgctgcccatcaggtggatggcctgggagtgtatcctcatggggaagttcacaacagccagtgatgtgtgggccttcggagtgaccctgtgggaggtgcttatgctctgcaggtcacagcccttcgggcaactcacagacgagcaggtcatcgagaacgccggcgagttcttcagggaccagggccggcaggtatacttatccaggccacccgcctgcccgcagaccttgtatgagctgatgctccggtgttggagccgggagccggagcagcggccgcccttctcccagcttcatcggttcctggcggatgatgcactcaacacagtgtaaactaaggacctggcagccctttttcactgggagccatccaggggaagctggacactaaaaccagagaagcctatggcaccccgcccaccatctccccgacttgcccattcccaagaggcagtgtctctgcaggtgggctgggcccgcccagggaaccgaagactctgttaccagatacgtgctcccttcctgttcttcctcccacctgccaagctccacccacccagctggccctgtggttgggatcctgcctgacttcttccagctatcccctagggaaagacaggggcgaatgctgggcacacactggacaaggcccactggacaacactggttcctgggaggtgacggtaccccccagcttcttcttgtcacacactggacaccgccagaattgagggggacgagggggacaaggaaggccaaccctctacaatggtcctcagccctggcttccttctgcaccctccgcctctgacacactggacctgggggtgacccctgctgtgatcctcagtcaaacacccctccttcctacctaccaccatgttgccgctagaacttccgcaaagcctctgcgttcctgtggagtaaatattaggatggggaacagatggagcagtagcccgaggccggggggtggggatttctcttgtagctaccacattggtttttctataatcacgtggggtttgtacattttttggggggagagacacagatttttacactaatatatggacctagctcgaggcagttttaatctcctgctctaggcaggtaata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]