GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-03 16:45:47, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_017601557            3914 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine
            kinase 1 (Ddr1), transcript variant X3, mRNA.
ACCESSION   XM_017601557
VERSION     XM_017601557.2
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051355.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_017601557.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3914
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="20"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3914
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="discoidin domain receptor tyrosine kinase 1;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 56 ESTs, 6 long SRA reads, 23 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 100 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
     CDS             396..3128
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /codon_start=1
                     /product="epithelial discoidin domain-containing receptor
                     1 isoform X1"
                     /protein_id="XP_017457046.1"
                     /db_xref="GeneID:25678"
                     /db_xref="RGD:2252"
                     /translation="
MGTGTLSSLLLLLLLVTIGDADMKGHFDPAKCRYALGMQDRTIPDSDISVSSSWSDSTAARHSRLESSDGDGAWCPAGPVFPKEEEYLQVDLRRLHLVALVGTQGRHAGGLGKEFSRSYRLRYSRDGRRWMDWKDRWGQEVISGNEDPGGVVLKDLGPPMVARLVRFYPRADRVMSVCLRVELYGCLWRDGLLSYTAPVGQTMQLSEMVYLNDSTYDGYTAGGLQYGGLGQLADGVVGLDDFRQSQELRVWPGYDYVGWSNHSFPSGYVEMEFEFDRLRSFQTMQVHCNNMHTLGARLPGGVECRFKRGPAMAWEGEPVRHALGGSLGDPRARAISVPLGGHVGRFLQCRFLFAGPWLLFSEISFISDVVNDSSDTFPPAPWWPPGPPPTNFSSLELEPRGQQPVAKAEGSPTAILIGCLVAIILLLLLIIALMLWRLHWRRLLSKAERRVLEEELTVHLSVPGDTILINNRPGPREPPPYQEPRPRGTPTHSAPCVPNGSALLLSNPAYRLLLATYARPPRGPGPPTPAWAKPTNTQACSGDYMEPEKPGAPLLPPPPQNSVPHYAEADIVTLQGVTGGNTYAVPALPPGAVGDGPPRVDFPRSRLRFKEKLGEGQFGEVHLCEVEDPQDLVTSDFPISVQKGHPLLVAVKILRPDATKNARNDFLKEVKIMSRLKDPNIIRLLGVCVQDDPLCMITDYMENGDLNQFLSAHQLENKVTQGLPGDRESDQGPTISYPMLLHVGAQIASGMRYLATLNFVHRDLATRNCLVGENFTIKIADFGMSRNLYAGDYYRVQGRAVLPIRWMAWECILMGKFTTASDVWAFGVTLWEVLMLCRSQPFGQLTDEQVIENAGEFFRDQGRQVYLSRPPACPQTLYELMLRCWSREPEQRPPFSQLHRFLADDALNTV"
     misc_feature    567..950
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Coagulation factor 5/8 C-terminal domain, discoidin
                     domain; Cell surface-attached carbohydrate-binding domain,
                     present in eukaryotes and assumed to have horizontally
                     transferred to eubacterial genomes; Region: FA58C;
                     cd00057"
                     /db_xref="CDD:238014"
     misc_feature    order(618..620,711..713,735..737)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="sugar binding site [chemical binding]; other site"
                     /db_xref="CDD:238014"
     misc_feature    2196..3107
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="Catalytic domain of the Protein Tyrosine Kinase,
                     Discoidin Domain Receptor 1; Region: PTKc_DDR1; cd05096"
                     /db_xref="CDD:133227"
     misc_feature    order(2232..2246,2256..2258,2343..2345,2349..2351,
                     2487..2498,2505..2510,2682..2684,2694..2699,2703..2705,
                     2736..2738,2790..2804,2829..2831,2934..2936)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="active site"
                     /db_xref="CDD:133227"
     misc_feature    order(2232..2237,2241..2246,2256..2258,2343..2345,
                     2349..2351,2487..2498,2505..2510,2694..2699,2703..2705,
                     2736..2738)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    order(2682..2684,2694..2696,2790..2804,2829..2831,
                     2934..2936)
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="polypeptide substrate binding site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:133227"
     misc_feature    2733..2810
                     /gene="Ddr1"
                     /gene_synonym="Cak; Drd1; PTK3D"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:133227"
ORIGIN      
gcacccaggaactccctgccagactttccagtcccaacggcttgcccctctgcactgcagggctgtatccccaagggactggtggtgatgcctcttgggttctaggctctccctctagccacccagtcagctcccctcagctgctgcttcagtgatggggtttttcagctgcctcctcttacattcctgccctagagcattgtgggagcagctggaggaggacaaagggctgggggagtctacccccaactcctcctacctcctggggtgacccagcctccctatagtttaagcctgccctcacctccaaggcaactcagtcctctcagccctgggctcttctgctaccttggagatgctgtcccctcctccataggccagagggatcaggagcgatggggacagggaccctctcatctctcctgctgctgctactcttggtgacaattggagatgctgacatgaagggacattttgacccagccaagtgccgctatgccctgggcatgcaggaccgcaccattccagacagcgatatctctgtgtccagctcctggtcggactctaccgccgcccgccacagcaggctggaaagcagtgatggagatggggcttggtgccctgcagggcctgtgttccccaaagaagaggagtacctgcaggtggaccttcgtaggctacacctggtggctctggtgggcacccagggccgccatgctgggggtctgggcaaagagttctcccgaagctaccggttgcgttactcccgagatggccgacgatggatggactggaaagacagatggggtcaggaggtgatttcgggtaacgaggatcctgggggagtggtgctgaaggatctcgggccccccatggtggcccggctggtccgtttctaccccagggctgaccgggtcatgagtgtctgtcttcgggtggagctctatggctgcctctggcgggacggactcttgtcctatacagcccccgtggggcagaccatgcaattatctgagatggtgtatctcaatgattccacttacgatggatatactgctggagggctgcagtacggtggtctgggccaactggcagacggcgtggtggggctggatgatttcaggcagagccaggagctgcgggtttggccaggctatgactatgtgggatggagcaaccatagcttccccagcggctacgtggagatggagtttgagtttgaccggctgaggtctttccagaccatgcaggtccactgtaacaacatgcacactctgggagcccgcctcccaggcggggtggaatgccggtttaaaaggggtccggccatggcctgggaaggagagcctgtacgccatgccctggggggtagccttggagaccccagagccagggccatctcggtgcccctgggtggtcacgtgggccgcttcctgcagtgcagattcctctttgcaggaccctggttactcttcagtgagatctctttcatctcggatgtggtgaacgactcgtctgacaccttcccaccagccccctggtggccgcctggcccgcctcccaccaacttcagcagcttggagctggagccccggggtcaacagcctgtggccaaggcggaggggagcccaactgccatcctcattggctgcctggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttggggaggtacatctctgtgaagtagaggaccctcaagatctggtcactagtgacttccctatcagtgtgcaaaagggacaccccttgctggtggcagtgaagatcctccggccagatgccaccaaaaatgccaggaatgacttcctgaaggaggtaaagatcatgtcacggctgaaggacccaaacatcatccggctcctgggtgtgtgtgtgcaggatgaccctctctgcatgattacagactacatggagaacggtgacctgaaccaattcctcagtgcccaccagctggagaacaaggtcactcaggggcttcctggggacagagagtctgaccaggggcccacaatcagctaccctatgctgttacacgtgggggcccagatcgcctctggcatgcgatatctggccacccttaactttgtgcatcgggacctggccacccggaactgcttggttggggaaaatttcaccatcaaaatcgccgactttggcatgagccggaatctctacgctggggattattaccgtgtacagggccgggcagtgctgcccatcaggtggatggcctgggagtgtatcctcatggggaagttcacaacagccagtgatgtgtgggccttcggagtgaccctgtgggaggtgcttatgctctgcaggtcacagcccttcgggcaactcacagacgagcaggtcatcgagaacgccggcgagttcttcagggaccagggccggcaggtatacttatccaggccacccgcctgcccgcagaccttgtatgagctgatgctccggtgttggagccgggagccggagcagcggccgcccttctcccagcttcatcggttcctggcggatgatgcactcaacacagtgtaaactaaggacctggcagccctttttcactgggagccatccaggggaagctggacactaaaaccagagaagcctatggcaccccgcccaccatctccccgacttgcccattcccaagaggcagtgtctctgcaggtgggctgggcccgcccagggaaccgaagactctgttaccagatacgtgctcccttcctgttcttcctcccacctgccaagctccacccacccagctggccctgtggttgggatcctgcctgacttcttccagctatcccctagggaaagacaggggcgaatgctgggcacacactggacaaggcccactggacaacactggttcctgggaggtgacggtaccccccagcttcttcttgtcacacactggacaccgccagaattgagggggacgagggggacaaggaaggccaaccctctacaatggtcctcagccctggcttccttctgcaccctccgcctctgacacactggacctgggggtgacccctgctgtgatcctcagtcaaacacccctccttcctacctaccaccatgttgccgctagaacttccgcaaagcctctgcgttcctgtggagtaaatattaggatggggaacagatggagcagtagcccgaggccggggggtggggatttctcttgtagctaccacattggtttttctataatcacgtggggtttgtacattttttggggggagagacacagatttttacactaatatatggacctagctcgaggcagttttaatctcctgctctaggcaggtaata
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]