GGRNA ver.2 Home | Help | Advanced search    Previous release (v1)

2024-05-03 10:19:10, GGRNA.v2 : RefSeq release 222 (Jan, 2024)

LOCUS       XM_017591589            3362 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation
            stimulator (Ralgds), transcript variant X4, mRNA.
ACCESSION   XM_017591589
VERSION     XM_017591589.2
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051338.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_017591589.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3362
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3362
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="ral guanine nucleotide dissociation stimulator;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 33 ESTs, 2 long SRA reads, 10 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 22 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
     CDS             30..2576
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /codon_start=1
                     /product="ral guanine nucleotide dissociation stimulator
                     isoform X4"
                     /protein_id="XP_017447078.1"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
                     /translation="
MQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"
     misc_feature    186..596
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     GTPases; N-terminal motif; Region: RasGEFN; smart00229"
                     /db_xref="CDD:214571"
     misc_feature    order(243..245,423..425,435..440,447..449,456..461,
                     570..575,582..584,603..605)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:100121"
     misc_feature    <609..>932
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="DNA polymerase III subunit gamma/tau; Region:
                     PRK07003"
                     /db_xref="CDD:235906"
     misc_feature    975..1763
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     small GTPases. Small GTP-binding proteins of the Ras
                     superfamily function as molecular switches in fundamental
                     events such as signal transduction, cytoskeleton dynamics
                     and intracellular trafficking; Region: RasGEF; cd00155"
                     /db_xref="CDD:238087"
     misc_feature    order(1074..1082,1119..1124,1128..1136,1140..1145,
                     1152..1157,1164..1166,1269..1271,1278..1283,1287..1295,
                     1299..1310,1314..1319,1377..1379,1386..1388,1401..1409,
                     1416..1418,1527..1535,1542..1550,1554..1562,1566..1577,
                     1620..1622,1632..1634,1737..1739,1746..1751)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238087"
     misc_feature    2223..2480
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras-associating (RA) domain found in Ral guanine
                     nucleotide dissociation stimulator (RalGDS) and similar
                     proteins; Region: RA_RalGDS; cd17209"
                     /db_xref="CDD:340729"
     misc_feature    order(2223..2234,2238..2240,2259..2285,2295..2300,
                     2322..2324,2331..2336,2340..2342)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="RA-Ras interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:340729"
ORIGIN      
gccacaaggacattcagatccacctgtctatgcagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg
//

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]