2024-05-07 20:42:36, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_017591589 3362 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X4, mRNA. ACCESSION XM_017591589 VERSION XM_017591589.2 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051338.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jan 21, 2021 this sequence version replaced XM_017591589.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3362 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="3" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..3362 /gene="Ralgds" /gene_synonym="Rgds" /note="ral guanine nucleotide dissociation stimulator; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 33 ESTs, 2 long SRA reads, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 22 samples with support for all annotated introns" /db_xref="GeneID:29622" /db_xref="RGD:3533" CDS 30..2576 /gene="Ralgds" /gene_synonym="Rgds" /codon_start=1 /product="ral guanine nucleotide dissociation stimulator isoform X4" /protein_id="XP_017447078.1" /db_xref="GeneID:29622" /db_xref="RGD:3533" /translation="
MQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"
misc_feature 186..596 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif; Region: RasGEFN; smart00229" /db_xref="CDD:214571" misc_feature order(243..245,423..425,435..440,447..449,456..461, 570..575,582..584,603..605) /gene="Ralgds" /gene_synonym="Rgds" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:100121" misc_feature <609..>932 /gene="Ralgds" /gene_synonym="Rgds" /note="DNA polymerase III subunit gamma/tau; Region: PRK07003" /db_xref="CDD:235906" misc_feature 975..1763 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like small GTPases. Small GTP-binding proteins of the Ras superfamily function as molecular switches in fundamental events such as signal transduction, cytoskeleton dynamics and intracellular trafficking; Region: RasGEF; cd00155" /db_xref="CDD:238087" misc_feature order(1074..1082,1119..1124,1128..1136,1140..1145, 1152..1157,1164..1166,1269..1271,1278..1283,1287..1295, 1299..1310,1314..1319,1377..1379,1386..1388,1401..1409, 1416..1418,1527..1535,1542..1550,1554..1562,1566..1577, 1620..1622,1632..1634,1737..1739,1746..1751) /gene="Ralgds" /gene_synonym="Rgds" /note="Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:238087" misc_feature 2223..2480 /gene="Ralgds" /gene_synonym="Rgds" /note="Ras-associating (RA) domain found in Ral guanine nucleotide dissociation stimulator (RalGDS) and similar proteins; Region: RA_RalGDS; cd17209" /db_xref="CDD:340729" misc_feature order(2223..2234,2238..2240,2259..2285,2295..2300, 2322..2324,2331..2336,2340..2342) /gene="Ralgds" /gene_synonym="Rgds" /note="RA-Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:340729" ORIGIN
gccacaaggacattcagatccacctgtctatgcagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]