LOCUS       XM_006233752            3733 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation
            stimulator (Ralgds), transcript variant X3, mRNA.
ACCESSION   XM_006233752
VERSION     XM_006233752.2
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051338.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Aug 7, 2014 this sequence version replaced XM_006233752.1.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3733
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3733
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="ral guanine nucleotide dissociation stimulator;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 34 ESTs, 2 long SRA reads, 10 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 186 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
     CDS             389..2947
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /codon_start=1
                     /product="ral guanine nucleotide dissociation stimulator
                     isoform X3"
                     /protein_id="XP_006233814.1"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
                     /translation="

MMVDCQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"

     misc_feature    557..967
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     GTPases; N-terminal motif; Region: RasGEFN; smart00229"
                     /db_xref="CDD:214571"
     misc_feature    order(614..616,794..796,806..811,818..820,827..832,
                     941..946,953..955,974..976)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:100121"
     misc_feature    <980..>1303
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="DNA polymerase III subunit gamma/tau; Region:
                     PRK07003"
                     /db_xref="CDD:235906"
     misc_feature    1346..2134
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     small GTPases. Small GTP-binding proteins of the Ras
                     superfamily function as molecular switches in fundamental
                     events such as signal transduction, cytoskeleton dynamics
                     and intracellular trafficking; Region: RasGEF; cd00155"
                     /db_xref="CDD:238087"
     misc_feature    order(1445..1453,1490..1495,1499..1507,1511..1516,
                     1523..1528,1535..1537,1640..1642,1649..1654,1658..1666,
                     1670..1681,1685..1690,1748..1750,1757..1759,1772..1780,
                     1787..1789,1898..1906,1913..1921,1925..1933,1937..1948,
                     1991..1993,2003..2005,2108..2110,2117..2122)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238087"
     misc_feature    2594..2851
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras-associating (RA) domain found in Ral guanine
                     nucleotide dissociation stimulator (RalGDS) and similar
                     proteins; Region: RA_RalGDS; cd17209"
                     /db_xref="CDD:340729"
     misc_feature    order(2594..2605,2609..2611,2630..2656,2666..2671,
                     2693..2695,2702..2707,2711..2713)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="RA-Ras interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:340729"
ORIGIN      

gtctagtcctcagcgtcccgcaaggaaggaggtcgagcgcgtccccgagctcgctcaccggggcccgcccctcgcacctgcgggcgagctgggcggggccggggcggggccgcactgtctccgcccactcgtcccgagccccgggagctccggcggaaccgagcagcgaggccctaaaaggccgtgagcgcggcgaggcgaggcgcggtgcagacaatgggagcggcattggcgagagccgcggagctccgggcctggcgaggaccggaggccgcgccatgagccccgcagccggacgccccgctgcgccgcgcgcgggccgaggcgagcggcctctgcgagtcccgggccgcgccctggggctggcgatgagctgccgaggctgaggatgatggtagattgccagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg

//