2024-05-05 07:45:50, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_006233752 3733 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X3, mRNA. ACCESSION XM_006233752 VERSION XM_006233752.2 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051338.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Aug 7, 2014 this sequence version replaced XM_006233752.1. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3733 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="3" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..3733 /gene="Ralgds" /gene_synonym="Rgds" /note="ral guanine nucleotide dissociation stimulator; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 34 ESTs, 2 long SRA reads, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 186 samples with support for all annotated introns" /db_xref="GeneID:29622" /db_xref="RGD:3533" CDS 389..2947 /gene="Ralgds" /gene_synonym="Rgds" /codon_start=1 /product="ral guanine nucleotide dissociation stimulator isoform X3" /protein_id="XP_006233814.1" /db_xref="GeneID:29622" /db_xref="RGD:3533" /translation="
MMVDCQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"
misc_feature 557..967 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif; Region: RasGEFN; smart00229" /db_xref="CDD:214571" misc_feature order(614..616,794..796,806..811,818..820,827..832, 941..946,953..955,974..976) /gene="Ralgds" /gene_synonym="Rgds" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:100121" misc_feature <980..>1303 /gene="Ralgds" /gene_synonym="Rgds" /note="DNA polymerase III subunit gamma/tau; Region: PRK07003" /db_xref="CDD:235906" misc_feature 1346..2134 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like small GTPases. Small GTP-binding proteins of the Ras superfamily function as molecular switches in fundamental events such as signal transduction, cytoskeleton dynamics and intracellular trafficking; Region: RasGEF; cd00155" /db_xref="CDD:238087" misc_feature order(1445..1453,1490..1495,1499..1507,1511..1516, 1523..1528,1535..1537,1640..1642,1649..1654,1658..1666, 1670..1681,1685..1690,1748..1750,1757..1759,1772..1780, 1787..1789,1898..1906,1913..1921,1925..1933,1937..1948, 1991..1993,2003..2005,2108..2110,2117..2122) /gene="Ralgds" /gene_synonym="Rgds" /note="Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:238087" misc_feature 2594..2851 /gene="Ralgds" /gene_synonym="Rgds" /note="Ras-associating (RA) domain found in Ral guanine nucleotide dissociation stimulator (RalGDS) and similar proteins; Region: RA_RalGDS; cd17209" /db_xref="CDD:340729" misc_feature order(2594..2605,2609..2611,2630..2656,2666..2671, 2693..2695,2702..2707,2711..2713) /gene="Ralgds" /gene_synonym="Rgds" /note="RA-Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:340729" ORIGIN
gtctagtcctcagcgtcccgcaaggaaggaggtcgagcgcgtccccgagctcgctcaccggggcccgcccctcgcacctgcgggcgagctgggcggggccggggcggggccgcactgtctccgcccactcgtcccgagccccgggagctccggcggaaccgagcagcgaggccctaaaaggccgtgagcgcggcgaggcgaggcgcggtgcagacaatgggagcggcattggcgagagccgcggagctccgggcctggcgaggaccggaggccgcgccatgagccccgcagccggacgccccgctgcgccgcgcgcgggccgaggcgagcggcctctgcgagtcccgggccgcgccctggggctggcgatgagctgccgaggctgaggatgatggtagattgccagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]