LOCUS       XM_006233751            3673 bp    mRNA    linear   ROD 11-JUN-2023
DEFINITION  PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation
            stimulator (Ralgds), transcript variant X2, mRNA.
ACCESSION   XM_006233751
VERSION     XM_006233751.4
DBLINK      BioProject: PRJNA677964
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NC_051338.1) annotated using gene prediction method: Gnomon,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jan 21, 2021 this sequence version replaced XM_006233751.3.
            
            ##Genome-Annotation-Data-START##
            Annotation Provider         :: NCBI RefSeq
            Annotation Status           :: Updated annotation
            Annotation Name             :: GCF_015227675.2-RS_2023_06
            Annotation Pipeline         :: NCBI eukaryotic genome annotation
                                           pipeline
            Annotation Software Version :: 10.1
            Annotation Method           :: Best-placed RefSeq; Gnomon;
                                           cmsearch; tRNAscan-SE
            Features Annotated          :: Gene; mRNA; CDS; ncRNA
            Annotation Date             :: 06/06/2023
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..3673
                     /organism="Rattus norvegicus"
                     /mol_type="mRNA"
                     /strain="BN/NHsdMcwi"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /sex="male"
                     /tissue_type="kidney"
                     /country="USA: Wisconsin, Milwaukee, Medical College of
                     Wisconsin"
                     /collection_date="2019-03-08"
                     /collected_by="Rebecca Schilling"
     gene            1..3673
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="ral guanine nucleotide dissociation stimulator;
                     Derived by automated computational analysis using gene
                     prediction method: Gnomon. Supporting evidence includes
                     similarity to: 35 ESTs, 2 long SRA reads, 10 Proteins, and
                     100% coverage of the annotated genomic feature by RNAseq
                     alignments, including 20 samples with support for all
                     annotated introns"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
     CDS             200..2887
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /codon_start=1
                     /product="ral guanine nucleotide dissociation stimulator
                     isoform X2"
                     /protein_id="XP_006233813.1"
                     /db_xref="GeneID:29622"
                     /db_xref="RGD:3533"
                     /translation="

MISGKNLALVLGKRAAVSQRAWLPPPLPSRALVFCFTLLWGETTRLLDQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"

     misc_feature    497..907
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     GTPases; N-terminal motif; Region: RasGEFN; smart00229"
                     /db_xref="CDD:214571"
     misc_feature    order(554..556,734..736,746..751,758..760,767..772,
                     881..886,893..895,914..916)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="GTPase interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:100121"
     misc_feature    <920..>1243
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="DNA polymerase III subunit gamma/tau; Region:
                     PRK07003"
                     /db_xref="CDD:235906"
     misc_feature    1286..2074
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Guanine nucleotide exchange factor for Ras-like
                     small GTPases. Small GTP-binding proteins of the Ras
                     superfamily function as molecular switches in fundamental
                     events such as signal transduction, cytoskeleton dynamics
                     and intracellular trafficking; Region: RasGEF; cd00155"
                     /db_xref="CDD:238087"
     misc_feature    order(1385..1393,1430..1435,1439..1447,1451..1456,
                     1463..1468,1475..1477,1580..1582,1589..1594,1598..1606,
                     1610..1621,1625..1630,1688..1690,1697..1699,1712..1720,
                     1727..1729,1838..1846,1853..1861,1865..1873,1877..1888,
                     1931..1933,1943..1945,2048..2050,2057..2062)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras interaction site [polypeptide binding]; other
                     site"
                     /db_xref="CDD:238087"
     misc_feature    2534..2791
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="Ras-associating (RA) domain found in Ral guanine
                     nucleotide dissociation stimulator (RalGDS) and similar
                     proteins; Region: RA_RalGDS; cd17209"
                     /db_xref="CDD:340729"
     misc_feature    order(2534..2545,2549..2551,2570..2596,2606..2611,
                     2633..2635,2642..2647,2651..2653)
                     /gene="Ralgds"
                     /gene_synonym="Rgds"
                     /note="RA-Ras interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:340729"
ORIGIN      

tgggctccactcacccacagcctctcccagctctctgctgacccttggtgtgggcttctctgctcgggccaagctgcaccagaacaacctatagttagccgatggccagagagccactgcctaaaattgcttctggccagccaggaaagaaggaagatccttgtgctgaaccagagctgacttggcatctcagagcaagatgatttctgggaagaacctggctcttgttctagggaaaagggcggctgtttcccagagagcctggctgccacctcccctaccttcccgtgctttggtgttttgcttcactctcctctggggcgagacaacgcgtctgctggatcagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg

//