2024-05-04 13:41:04, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS XM_006233751 3673 bp mRNA linear ROD 11-JUN-2023 DEFINITION PREDICTED: Rattus norvegicus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant X2, mRNA. ACCESSION XM_006233751 VERSION XM_006233751.4 DBLINK BioProject: PRJNA677964 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NC_051338.1) annotated using gene prediction method: Gnomon, supported by EST evidence. Also see: Documentation of NCBI's Annotation Process On Jan 21, 2021 this sequence version replaced XM_006233751.3. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI RefSeq Annotation Status :: Updated annotation Annotation Name :: GCF_015227675.2-RS_2023_06 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Software Version :: 10.1 Annotation Method :: Best-placed RefSeq; Gnomon; cmsearch; tRNAscan-SE Features Annotated :: Gene; mRNA; CDS; ncRNA Annotation Date :: 06/06/2023 ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..3673 /organism="Rattus norvegicus" /mol_type="mRNA" /strain="BN/NHsdMcwi" /db_xref="taxon:10116" /chromosome="3" /sex="male" /tissue_type="kidney" /country="USA: Wisconsin, Milwaukee, Medical College of Wisconsin" /collection_date="2019-03-08" /collected_by="Rebecca Schilling" gene 1..3673 /gene="Ralgds" /gene_synonym="Rgds" /note="ral guanine nucleotide dissociation stimulator; Derived by automated computational analysis using gene prediction method: Gnomon. Supporting evidence includes similarity to: 35 ESTs, 2 long SRA reads, 10 Proteins, and 100% coverage of the annotated genomic feature by RNAseq alignments, including 20 samples with support for all annotated introns" /db_xref="GeneID:29622" /db_xref="RGD:3533" CDS 200..2887 /gene="Ralgds" /gene_synonym="Rgds" /codon_start=1 /product="ral guanine nucleotide dissociation stimulator isoform X2" /protein_id="XP_006233813.1" /db_xref="GeneID:29622" /db_xref="RGD:3533" /translation="
MISGKNLALVLGKRAAVSQRAWLPPPLPSRALVFCFTLLWGETTRLLDQSSTQEIGEELINGVIYSISLRKVQLHPGATKGQRWLGCENESALNLYETCKVRTVKAGTLEKLVEHLVPAFQGSDLSYVTVFLCTYRAFTTTQQVLDLLFKRYGRCDALTASSRYGCILPYSSEDGGPQDQLKNAISSILGTWLDQYSEDFCQPPDFPCLKQLVAYVQLNMPGSDLERRAHLLLAQLEDLEPSEVEPEALSPAPVLSLKPASQLEPAPALLLTPSRAVASTPVREPAPVPVLASSPVVAPASELEPALEPPLDPEPTLAPAPELDPTVSQSLHLEPAPVPAPALEPSWPLPETTENGLCAKPHLLLFPPDLVAEQFTLMDAELFKKVVPYHCLGSIWSQRDKKGKEHLAPTIRATVAQFNNVANCVITTCLGDQSMKASDRARVVEHWIEVARECRVLKNFSSLYAILSALQSNAIHRLKKTWEEVSRGSFRVFQKLSEIFSDENNYSLSRELLIKEGTSKFATLEMNPRRTQRRQKETGVIQGTVPYLGTFLTDLVMLDTAMKDYLYGRLINFEKRRKEFEVIAQIKLLQSACNNYSIVPEEHFGAWFRAMGRLSEAESYNLSCELEPPSESASNTLRSKKSTAIVKRWSDRQAPSTELSTSSSAHSKSCDQLRCSPYLSSGDITDALSVHSAGSSSSDVEEINMSFVPESPDGQEKKFWESASQSSPETSGISSASSSTSSSSASTTPVSTTRTHKRSVSGVCSYSSSLPLYNQQVGDCCIIRVSLDVDNGNMYKSILVTSQDKAPTVIRKAMDKHNLDEDEPEDYELLQIISEDHKLKIPENANVFYAMNSAANYDFILKKRAFTKGAKVKHGASSTLPRMKQKGLRIARGIF"
misc_feature 497..907 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like GTPases; N-terminal motif; Region: RasGEFN; smart00229" /db_xref="CDD:214571" misc_feature order(554..556,734..736,746..751,758..760,767..772, 881..886,893..895,914..916) /gene="Ralgds" /gene_synonym="Rgds" /note="GTPase interaction site [polypeptide binding]; other site" /db_xref="CDD:100121" misc_feature <920..>1243 /gene="Ralgds" /gene_synonym="Rgds" /note="DNA polymerase III subunit gamma/tau; Region: PRK07003" /db_xref="CDD:235906" misc_feature 1286..2074 /gene="Ralgds" /gene_synonym="Rgds" /note="Guanine nucleotide exchange factor for Ras-like small GTPases. Small GTP-binding proteins of the Ras superfamily function as molecular switches in fundamental events such as signal transduction, cytoskeleton dynamics and intracellular trafficking; Region: RasGEF; cd00155" /db_xref="CDD:238087" misc_feature order(1385..1393,1430..1435,1439..1447,1451..1456, 1463..1468,1475..1477,1580..1582,1589..1594,1598..1606, 1610..1621,1625..1630,1688..1690,1697..1699,1712..1720, 1727..1729,1838..1846,1853..1861,1865..1873,1877..1888, 1931..1933,1943..1945,2048..2050,2057..2062) /gene="Ralgds" /gene_synonym="Rgds" /note="Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:238087" misc_feature 2534..2791 /gene="Ralgds" /gene_synonym="Rgds" /note="Ras-associating (RA) domain found in Ral guanine nucleotide dissociation stimulator (RalGDS) and similar proteins; Region: RA_RalGDS; cd17209" /db_xref="CDD:340729" misc_feature order(2534..2545,2549..2551,2570..2596,2606..2611, 2633..2635,2642..2647,2651..2653) /gene="Ralgds" /gene_synonym="Rgds" /note="RA-Ras interaction site [polypeptide binding]; other site" /db_xref="CDD:340729" ORIGIN
tgggctccactcacccacagcctctcccagctctctgctgacccttggtgtgggcttctctgctcgggccaagctgcaccagaacaacctatagttagccgatggccagagagccactgcctaaaattgcttctggccagccaggaaagaaggaagatccttgtgctgaaccagagctgacttggcatctcagagcaagatgatttctgggaagaacctggctcttgttctagggaaaagggcggctgtttcccagagagcctggctgccacctcccctaccttcccgtgctttggtgttttgcttcactctcctctggggcgagacaacgcgtctgctggatcagagctctacgcaggagattggggaggagctgatcaacggggtcatctactccatctccctgcgcaaggttcagctacacccaggagccaccaagggccagcgctggctagggtgcgagaatgagtcagctctgaacctctacgagacttgcaaggtgcgcacggtgaaggccggtactctggagaagctggtggaacacctggtgcctgccttccagggcagtgacctttcctacgtcaccgtattcctgtgcacctacagagccttcacaaccactcagcaggtgctagacctgctgttcaaaaggtacggtagatgtgacgccctcacggcctcctctagatatggctgcatccttccctactccagtgaggacggcggaccacaggaccaactcaaaaatgccatctcttccatcctgggcacctggctggaccaatactccgaggacttctgtcaacccccggactttccctgcctcaagcagctggtggcttatgtgcagctcaacatgcctggctcagacctggagcgccgtgctcaccttctcctggcccagctggaggacctggagcccagtgaggttgagcctgaggccctgtccccagctccagtgctgtctctgaaaccagcttcacagctagaaccagctcccgccctgcttctgacgcccagccgagctgtggcatccactccagtccgagagccagccccggtgccagtactggcatccagcccggtggtggcgccagcctctgagctagaaccagctctggagccgcccctagaccctgagccaaccctcgcacctgctccagagctggaccccactgtctcacagagcctccacctcgagcccgctcccgtgcccgctcctgcattagagccttcctggcctctgcctgaaaccacggagaacggactgtgtgcaaagcctcacctactgctgttccctccagacttggtggctgaacagtttacgctgatggacgcagagctattcaagaaagttgtgccctaccactgcctgggctccatctggtcccagcgggacaagaagggcaaggagcacctcgcgcccaccatccgtgccactgtcgcccagttcaacaacgtggccaactgtgtcatcaccacctgccttggggaccagagtatgaaagcttcggacagggcccgggtggtggaacactggatcgaggtggccagggagtgcagggtgctcaagaatttctcctccctctacgccatcctctctgccctacagagcaatgccatccaccgcctaaagaagacatgggaagaggtctccaggggcagctttcgagtgttccagaaactgtcagaaatcttctctgatgagaacaactactccttgagcagagagctgctcatcaaggaaggaacctccaagtttgccacgctggagatgaaccctaggagaacccagaggcggcagaaggagacaggtgtcatccagggcactgtcccctacctgggcacattcctcactgacctggtgatgctggacacagccatgaaggactatctatatgggagactgatcaactttgaaaagaggaggaaggagttcgaagtcatcgcccagatcaagttgctccagtcggcctgcaacaactacagcattgttcccgaggagcactttggagcctggttccgagccatgggacggctcagcgaggctgagagctacaacctgtcgtgtgagctggagcccccgtctgagtcagccagcaacaccctgaggagcaagaaaagcacagctatcgtcaagcgctggagcgaccgccaggctcccagcacggagctcagcaccagtagcagtgcacactccaagtcatgtgaccagctccggtgcagcccctacctcagcagcggggacatcacggacgcactcagtgtgcactcagctggttcatccagctctgacgtggaggagatcaacatgagctttgttccagagtctcctgatggccaggaaaagaagttctgggagtcagcctcccagtcgtccccagagacctctggcatcagctcggcctccagcagcacctcctcttcgtcagcctctaccacaccggtgtctaccacacgcacccacaagcgctctgtctcaggggtctgcagctacagctcctcactgccactctacaaccagcaggtgggcgactgctgcatcatcagggtcagcctggatgtggacaacggcaacatgtacaagagcatcctggtgaccagccaggataaggctccgactgtcatccggaaagccatggacaaacacaacctagatgaggacgagcccgaggactatgagctgctgcagatcatctcagaggaccacaagctgaaaattccagagaacgccaatgtgttctatgccatgaactctgccgccaactatgacttcatcctaaagaagcgggccttcactaagggggctaaagtcaagcatggagccagctccactctccctcgaatgaagcagaagggactcaggattgccagaggcatcttctaaggacgtctcccaggggctggctggctggctggggactaagcacttacagactagagtggcccaggccacacaggtacctctgccctcctgccagcccaggctactcccagactccactttcaccccgaacctgtcctgctgccgggattgacacctgccactgacaggctgacctggcctccggggaccgctcaccgccttaggtgccttctgctctctgcaaccagaggactagctgactttgccaaggggtgctgccagctgggcatggagcctcgcctgccctggacaatgtccaccacactttcctgtcacctccccaagtgcagatcactgccacccatgctcccagatgctccaggacacccacacacccagcggggctgccaactgcgttctctccttgtgcccataggcactggcctgggaccttcatggaggtcctagcctttcttaggctgcaccaaagattccaccttcagggcctacagagtgagggagtctcgcccaccacgagcccaagccctcccatggatcagagagagaagccctctcatggaccgcctggttggcattgaaccccataccactgaaagtgccattcaccaccgctgcgtcccgggtgtacaagactacatgcaatgggaggtttgtggggagggggaagacgactggatatttgtataaaacgtaaaaagtttactgattggggtggggcaatatttatttgttgtaaatagaaaatgctagacttgaatattatattaaaatcccgtttctactatg
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]