GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-16 23:44:36, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus enolase 1 (Eno1), transcript variant 1, mRNA. (1754 bp)
ccccctgccgatctgagcgcctggccaagtacaatcagatccttagaatcgaggaggagctgggcagcaaagccaagtttgccggcaggtccttcaggaaccccctggccaagtaaggcatggaccggagatccctggagctaccagatcctctgtctctgtcatccaggcggctcaaggctggcccagtgcttgcccctcccatgtcactgcttccttagatgtccaccccgaccacctggagccctgctggagcccccagctttgtaatcatgtgatcagtctgaatcattgtttctgtcacctgactttccagctagtgtctggagccctctgaactccagcgtaatctctagggtgcccacaccatcaagactccccccagtggtttacttgcaaaaataaaagctgcagaagcccaaaaaaaaaaaaaaaaaaaaaaaa
position 1573 1577 1579 1581 1585 1591 1593 1595 1597 1624 1626 1631 1633 1637 1639 1641
Synonym: Nne
NM_012554.3 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus enolase 1 (Eno1), transcript variant 2, mRNA. (1803 bp)
ccccctgccgatctgagcgcctggccaagtacaatcagatccttagaatcgaggaggagctgggcagcaaagccaagtttgccggcaggtccttcaggaaccccctggccaagtaaggcatggaccggagatccctggagctaccagatcctctgtctctgtcatccaggcggctcaaggctggcccagtgcttgcccctcccatgtcactgcttccttagatgtccaccccgaccacctggagccctgctggagcccccagctttgtaatcatgtgatcagtctgaatcattgtttctgtcacctgactttccagctagtgtctggagccctctgaactccagcgtaatctctagggtgcccacaccatcaagactccccccagtggtttacttgcaaaaataaaagctgcagaagcccaaaaaaaaaaaaaaaaaaaaaaaa
position 1622 1626 1628 1630 1634 1640 1642 1644 1646 1673 1675 1680 1682 1686 1688 1690
Synonym: Nne
NM_001109908.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus enolase 1 (Eno1), transcript variant X1, mRNA. (1751 bp)
ccccctgccgatctgagcgcctggccaagtacaatcagatccttagaatcgaggaggagctgggcagcaaagccaagtttgccggcaggtccttcaggaaccccctggccaagtaaggcatggaccggagatccctggagctaccagatcctctgtctctgtcatccaggcggctcaaggctggcccagtgcttgcccctcccatgtcactgcttccttagatgtccaccccgaccacctggagccctgctggagcccccagctttgtaatcatgtgatcagtctgaatcattgtttctgtcacctgactttccagctagtgtctggagccctctgaactccagcgtaatctctagggtgcccacaccatcaagactccccccagtggtttacttgcaaaaataaaagctgcagaagccca
position 1593 1597 1599 1601 1605 1611 1613 1615 1617 1644 1646 1651 1653 1657 1659 1661
Synonym: Nne
XM_006239444.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/X02610_g_at
lang : en | div : | spe : rn | query_string : X02610_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.088 | 0.088 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTGGAGCCCTCTGAACTCCAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.100 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGAATCATTGTTTCTGTCACCTGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.109 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGGAGCCCTCTGAACTCCAGCGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.120 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGAATCATTGTTTCTGTCACCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCATGTGATCAGTCTGAATCATTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.141 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGATCAGTCTGAATCATTGTTTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.151 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTAATCATGTGATCAGTCTGAATCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.161 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTAGTGTCTGGAGCCCTCTGAACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.171 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCCTCTGAACTCCAGCGTAATCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.181 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGCCCTCTGAACTCCAGCGTAATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.193 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTTTGTAATCATGTGATCAGTCTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.203 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTCTGAACTCCAGCGTAATCTCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.213 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGCTAGTGTCTGGAGCCCTCTGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTCTGAATCATTGTTTCTGTCACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.271 | 0.047 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATCATTGTTTCTGTCACCTGACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.281 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATCATGTGATCAGTCTGAATCATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.314 | 0.033 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTGGAGCCCTCTGAACTCCAGC)%26(nt:TGAATCATTGTTTCTGTCACCTGAC)%26(nt:TCTGGAGCCCTCTGAACTCCAGCGT)%26(nt:TCTGAATCATTGTTTCTGTCACCTG)%26(nt:TCATGTGATCAGTCTGAATCATTGT)%26(nt:GTGATCAGTCTGAATCATTGTTTCT)%26(nt:GTAATCATGTGATCAGTCTGAATCA)%26(nt:GCTAGTGTCTGGAGCCCTCTGAACT)%26(nt:GCCCTCTGAACTCCAGCGTAATCTC)%26(nt:GAGCCCTCTGAACTCCAGCGTAATC)%26(nt:CTTTGTAATCATGTGATCAGTCTGA)%26(nt:CCTCTGAACTCCAGCGTAATCTCTA)%26(nt:CAGCTAGTGTCTGGAGCCCTCTGAA)%26(nt:AGTCTGAATCATTGTTTCTGTCACC)%26(nt:AATCATTGTTTCTGTCACCTGACTT)%26(nt:AATCATGTGATCAGTCTGAATCATT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.317 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]