GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:24:02, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus mast cell protease 9 (Mcpt9), mRNA. (823 bp)
aaacctgggcaggtgtgcacagtggcaggttgggggaccttggccaattgtactttgtctaacacacttcaagaagtgaatctagaagttcaaaaaggtcagaagtgccaaggcatgtccagaaactacaatgactccatccagctttgtgtgggaaaccccaatgagaggaaggctactgctgggggagactcagggggtccatttgtgtgcaatggagtggcccagggcattgtcagttatcgcttgtgtacttggacacctcctcgagtattcaccagaatctccagcttcataccgtggattcagaaaacaatgaaactccttcaacaaccctagaacacaaaacctgtgtctgggccaatgtccagcatcctggggtatggctatctgagtcttaataaagaaatctgtctgcagg
position 617 622 625 630 633 668 737 740 744 753 757 760 764 771 778 787
NM_019323.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus mast cell protease 8 (Mcpt8), mRNA. (847 bp)
aaacctgggcaggtgtgcacagtggcaggttggggatgcttggccaattgtagtttgtctaacacacttcaagaagtgaatctagaagttcaggaaggccagaagtgtgaagacatgtccagaaactacaacgactccatccagctttgtgtgggaaaccccagcgaggggaaggctactggtaagggagactcagggggtccctttgtgtgcgatggagtggcccagggcattgtcagttatcgcttgtgtactgggacacttcctcgagtattcaccagaatctccagctttataccgtggattcagaaaacaatgaaactccttcaacaatcctagaacacaaaacctgtgtctgggccaatgtccagcatcctggggtatggctatctgagtcttaataaagaaatctgtctgcagtaaaaaaaa
position 633 638 641 646 649 684 753 756 760 769 773 776 780 787 794 803
Synonym: RGD1565970; RMCP8
NM_021598.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus mast cell protease 10 (Mcpt10), mRNA. (861 bp)
aaacctgggcaggtgtgcacagtggcaggttggggatgcttggccaattgtagtttgtctaacacacttcaagaagtgaatctagaagttcaggaaggccagaagtgtgaagacatgtccagaaactacaacgactccatccagctttgtgtgggaaaccccagcgaggggaaggctactggtaagggagactcagggggtccctttgtgtgcgatggagtggcccagggcattgtcagttatcgcttgtgtactgggacacttcctcgagtattcaccagaatctccagctttataccgtggattcagaaaacaatgaaactccttcaacaatcctagaacacaaaacctgtgtctgggccaatgtccagcatcctggggtatggctatctgagtcttaataaagaaatctgtctgcagtaaa
position 652 657 660 665 668 703 772 775 779 788 792 795 799 806 813 822
Synonym: GLP II; GLP-2; rMCP-10; rMCP-X
NM_017146.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/U67911_s_at
lang : en | div : | spe : rn | query_string : U67911_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTCTGGGCCAATGTCCAGCATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.098 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGGGCCAATGTCCAGCATCCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.108 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGGCCCAGGGCATTGTCAGTTATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.118 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCCAATGTCCAGCATCCTGGGGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.128 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGGCATTGTCAGTTATCGCTTGTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.138 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTATCTGAGTCTTAATAAAGAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.149 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCCAGGGCATTGTCAGTTATCGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.160 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGGGTATGGCTATCTGAGTCTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.169 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCGAGTATTCACCAGAATCTCCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.180 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTAGAACACAAAACCTGTGTCTGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.191 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATTGTCAGTTATCGCTTGTGTACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.201 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGCATCCTGGGGTATGGCTATCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.211 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACAAAACCTGTGTCTGGGCCAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.222 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATGTCCAGCATCCTGGGGTATGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.233 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGGAGTGGCCCAGGGCATTGTCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.243 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAACACAAAACCTGTGTCTGGGCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.287 | 0.044 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTGTCTGGGCCAATGTCCAGCATC)%26(nt:TCTGGGCCAATGTCCAGCATCCTGG)%26(nt:GTGGCCCAGGGCATTGTCAGTTATC)%26(nt:GGGCCAATGTCCAGCATCCTGGGGT)%26(nt:GGGCATTGTCAGTTATCGCTTGTGT)%26(nt:GGCTATCTGAGTCTTAATAAAGAAA)%26(nt:GCCCAGGGCATTGTCAGTTATCGCT)%26(nt:CTGGGGTATGGCTATCTGAGTCTTA)%26(nt:CTCGAGTATTCACCAGAATCTCCAG)%26(nt:CCTAGAACACAAAACCTGTGTCTGG)%26(nt:CATTGTCAGTTATCGCTTGTGTACT)%26(nt:CAGCATCCTGGGGTATGGCTATCTG)%26(nt:CACAAAACCTGTGTCTGGGCCAATG)%26(nt:CAATGTCCAGCATCCTGGGGTATGG)%26(nt:ATGGAGTGGCCCAGGGCATTGTCAG)%26(nt:AGAACACAAAACCTGTGTCTGGGCC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.290 | 0.003 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]