GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:59:31, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus solute carrier family 7 member 2 (Slc7a2), transcript variant 2, mRNA. (2500 bp)
ctggctggtgctgcaacgtgcttttatgcctttgtgggctttgactgcattgcaacaaccggcgaagaggtccggaatccccaaaaggctattcccattggaatagtaacttccttacttgtttgctttatggcctattttggggtttctgcagctttaacacttatgatgccttactacctcctggatgagaaaagcccactccctgttgcatttgaatatgtcggatggggtcctgctaaatacgttgtcgccgcaggctccctctgcgccttatcaacaagtcttcttggatccattttcccaatgcctcgtgtaatctatgctatggcggaggatgggttgcttttcaaatgtctagctcaaatcaattccaaaacgaagacaccaataattgctactttgtcatcgggtgcagtggcagctgtgatggcctttctttttgacctgaaggctctcgtggacatgatgtctattggcaccctcatggcctactctctggtcgcagcctgtgtgctcattctcaggtaccaacctggcttgtgttatgagcagcccaaatacacccctgagaaagacattctggagtcatgtaccaat...
position 993 1095 1101 1119 1215 1221 1299 1305 1353 1395 1401 1413 1449 1455 1485 1491
Synonym: Cat2; Cat2a; Cat2b
NM_001134686.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus solute carrier family 7 member 2 (Slc7a2), transcript variant X1, mRNA. (10378 bp)
ctggctggtgctgcaacgtgcttttatgcctttgtgggctttgactgcattgcaacaaccggcgaagaggtccggaatccccaaaaggctattcccattggaatagtaacttccttacttgtttgctttatggcctattttggggtttctgcagctttaacacttatgatgccttactacctcctggatgagaaaagcccactccctgttgcatttgaatatgtcggatggggtcctgctaaatacgttgtcgccgcaggctccctctgcgccttatcaacaagtcttcttggatccattttcccaatgcctcgtgtaatctatgctatggcggaggatgggttgcttttcaaatgtctagctcaaatcaattccaaaacgaagacaccaataattgctactttgtcatcgggtgcagtggcagctgtgatggcctttctttttgacctgaaggctctcgtggacatgatgtctattggcaccctcatggcctactctctggtcgcagcctgtgtgctcattctcaggtaccaacctggcttgtgttatgagcagcccaaatacacccctgagaaagacattctggagtcatgtaccaat...
position 8213 8315 8321 8339 8435 8441 8519 8525 8573 8615 8621 8633 8669 8675 8705 8711
Synonym: Cat2; Cat2a; Cat2b
XM_008771282.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/U53927_at
lang : en | div : | spe : rn | query_string : U53927_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTGTTATGAGCAGCCCAAATACA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTCATCGGGTGCAGTGGCAGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCAAATGTCTAGCTCAAATCAATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.125 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCTAGCTCAAATCAATTCCAAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.136 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTTCTGCAGCTTTAACACTTATGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.146 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTTATCAACAAGTCTTCTTGGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.167 | 0.021 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGCTTTAACACTTATGATGCCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.177 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGCCTGTGTGCTCATTCTCAGGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.187 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTGCATTGCAACAACCGGCGAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.197 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCTGAAGGCTCTCGTGGACATGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.207 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACATGATGTCTATTGGCACCCTCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.217 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGGTCGCAGCCTGTGTGCTCATTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.227 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGCGCCTTATCAACAAGTCTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.237 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGGCTTGTGTTATGAGCAGCCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.282 | 0.044 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGCCTTACTACCTCCTGGATGAGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.294 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGCTCTCGTGGACATGATGTCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.318 | 0.024 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGTGTTATGAGCAGCCCAAATACA)%26(nt:TTGTCATCGGGTGCAGTGGCAGCTG)%26(nt:TTCAAATGTCTAGCTCAAATCAATT)%26(nt:TGTCTAGCTCAAATCAATTCCAAAA)%26(nt:GTTTCTGCAGCTTTAACACTTATGA)%26(nt:GCCTTATCAACAAGTCTTCTTGGAT)%26(nt:GCAGCTTTAACACTTATGATGCCTT)%26(nt:GCAGCCTGTGTGCTCATTCTCAGGT)%26(nt:GACTGCATTGCAACAACCGGCGAAG)%26(nt:GACCTGAAGGCTCTCGTGGACATGA)%26(nt:GACATGATGTCTATTGGCACCCTCA)%26(nt:CTGGTCGCAGCCTGTGTGCTCATTC)%26(nt:CTCTGCGCCTTATCAACAAGTCTTC)%26(nt:CCTGGCTTGTGTTATGAGCAGCCCA)%26(nt:ATGCCTTACTACCTCCTGGATGAGA)%26(nt:AAGGCTCTCGTGGACATGATGTCTA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.321 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]