GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:08:41, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus dihydropyrimidinase-like 4 (Dpysl4), mRNA. (2644 bp)
tgaatccagggagggttcactgccagagtgagaggattaggcagggcagtgagctggtgcctcttgccccacccctgaccttaccatgaaggccgtccacgagagctctcagcctccagcctgtgaactttccagggcctggtggtaggcagggtgggtgtttgctgctgccaccccctcagaaatcactgccctgtggaagcccccaagcttccaccagttccatgttgctaaaggtgcagcgaccccttgggggcctgtcccctctggctgccctggtgtagggaggagagcaggtgagcggagcctccgcttggcagagctgctgtgacttcagggatccaccagttactcagtgcagggtcgctccctcccacatagtcccttgcaaggaccaaacctgagctcctatagcagccgccctctagggagtttgatgatcccttagctaagacactttccttttcctacaaagtgtgttttcataggtttattagagtagctgttttggactgtgaggaaaccatagccagggatctgcatgctgctgtaccagacaccggccaccggccaagctgatttgagtcaggtcaataaaaa...
position 2031 2115 2223 2235 2241 2325 2331 2355 2361 2451 2535 2541 2547 2553 2577 2583
Synonym: Crmp3; Dpys4
NM_012933.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/U52103_at
lang : en | div : | spe : rn | query_string : U52103_at | format : html | download :

0.000 | 0.000 | search_start;
0.085 | 0.085 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCACTGCCAGAGTGAGAGGATTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.096 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTTGCTAAAGGTGCAGCGACCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.106 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTCCATGTTGCTAAAGGTGCAGCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.117 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCCACCGGCCAAGCTGATTTGAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.128 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCAGAGCTGCTGTGACTTCAGGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.141 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGATCCCTTAGCTAAGACACTTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.151 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAAACCATAGCCAGGGATCTGCATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.161 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTGCATGCTGCTGTACCAGACACCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.171 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGGCCAAGCTGATTTGAGTCAGGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.181 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGAGAGCTCTCAGCCTCCAGCCTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.191 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGCTTGGCAGAGCTGCTGTGACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.203 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGTTACTCAGTGCAGGGTCGCTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCACCAGTTACTCAGTGCAGGGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.225 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATAGCCAGGGATCTGCATGCTGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.236 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGGATCTGCATGCTGCTGTACCAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.246 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGCTTCCACCAGTTCCATGTTGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.271 | 0.025 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCACTGCCAGAGTGAGAGGATTAG)%26(nt:TGTTGCTAAAGGTGCAGCGACCCCT)%26(nt:GTTCCATGTTGCTAAAGGTGCAGCG)%26(nt:GGCCACCGGCCAAGCTGATTTGAGT)%26(nt:GGCAGAGCTGCTGTGACTTCAGGGA)%26(nt:GATGATCCCTTAGCTAAGACACTTT)%26(nt:GAAACCATAGCCAGGGATCTGCATG)%26(nt:CTGCATGCTGCTGTACCAGACACCG)%26(nt:CGGCCAAGCTGATTTGAGTCAGGTC)%26(nt:CGAGAGCTCTCAGCCTCCAGCCTGT)%26(nt:CCGCTTGGCAGAGCTGCTGTGACTT)%26(nt:CAGTTACTCAGTGCAGGGTCGCTCC)%26(nt:ATCCACCAGTTACTCAGTGCAGGGT)%26(nt:ATAGCCAGGGATCTGCATGCTGCTG)%26(nt:AGGGATCTGCATGCTGCTGTACCAG)%26(nt:AAGCTTCCACCAGTTCCATGTTGCT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.273 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]