GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:14:12, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus cellular retinoic acid binding protein 2 (Crabp2), mRNA. (789 bp)
gaacatgatgatgaggaagattgctgtggctgcagcctccaagccagcagtggagatcaaacaggagaatgatgacactttctacatcaaaacctccaccactgttcgaaccacggagattaacttcaagatcggggaggaatttgaagagcagactgtggatgggagaccctgtaagagtttggtgaaatgggagagtgaaaacaaaatggtgtgcgaacagaggcttctgaagggggagggccccaaaacctcctggagccgagaactgaccaatgatggagagctaatcctgaccatgacagcagacgacgttgtatgcaccagggtctacgtccgagagtgagtgcctatgtcccaagaacttcttctgggaggcccaccaaacctccctccctcccatgtccattttacaaactagctctccccttactcctgagggtcactctctatgccagagaggggcagactaccaaagctcagaacccttccatttgcctggtcagaagtcccagctccataccaggatccttcctggaagagactgtctctctggcctctactctttatccttgtagtccaagtgatttagaatattta...
position 222 252 438 444 450 474 480 486 516 528 618 624 678 726 732 735
NM_017244.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/U23407_at
lang : en | div : | spe : rn | query_string : U23407_at | format : html | download :

0.000 | 0.000 | search_start;
0.089 | 0.089 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCTGGCCTCTACTCTTTATCCTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGAGTGCCTATGTCCCAAGAACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.109 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTCTCTCTGGCCTCTACTCTTTATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.120 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGCCGAGAACTGACCAATGATGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGACTGTCTCTCTGGCCTCTACTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.141 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCATGACAGCAGACGACGTTGTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.151 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACAGCAGACGACGTTGTATGCACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.162 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAATGATGACACTTTCTACATCAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.172 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCTGGAGCCGAGAACTGACCAAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.182 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCTGAGGGTCACTCTCTATGCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.193 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCCAAGCCAGCAGTGGAGATCAAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.204 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTACGTCCGAGAGTGAGTGCCTATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATTTGCCTGGTCAGAAGTCCCAGCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.224 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGGTCACTCTCTATGCCAGAGAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.234 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAACTGACCAATGATGGAGAGCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.244 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATCCTGACCATGACAGCAGACGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.267 | 0.023 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTCTGGCCTCTACTCTTTATCCTT)%26(nt:GTGAGTGCCTATGTCCCAAGAACTT)%26(nt:GTCTCTCTGGCCTCTACTCTTTATC)%26(nt:GAGCCGAGAACTGACCAATGATGGA)%26(nt:GAGACTGTCTCTCTGGCCTCTACTC)%26(nt:GACCATGACAGCAGACGACGTTGTA)%26(nt:GACAGCAGACGACGTTGTATGCACC)%26(nt:GAATGATGACACTTTCTACATCAAA)%26(nt:CTCCTGGAGCCGAGAACTGACCAAT)%26(nt:CTCCTGAGGGTCACTCTCTATGCCA)%26(nt:CTCCAAGCCAGCAGTGGAGATCAAA)%26(nt:CTACGTCCGAGAGTGAGTGCCTATG)%26(nt:ATTTGCCTGGTCAGAAGTCCCAGCT)%26(nt:AGGGTCACTCTCTATGCCAGAGAGG)%26(nt:AGAACTGACCAATGATGGAGAGCTA)%26(nt:AATCCTGACCATGACAGCAGACGAC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.268 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]