GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 22:17:34, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus secreted phosphoprotein 2 (Spp2), mRNA. (947 bp)
catgaacttagagttcaccgttcaggaaactacatgcctaagagagtctggtgatccctccacctgcgccttccaaaggggctactctgtgccaacagctgcttgcaggagcacagtgcagatgtccaagggacaggtgaaggatgtgtgggctcactgccgctgggcgtccacatccgagtccaacagcagtgaggagatgatttttggggacatggcaagatcccaccgacgaagaaatgattatctacttggctttctttatgatgaacccaaaggtgagcagttctatgaccggtcgattgagatcacgaggaggggacatcctcctgcccatagaaggttcctgaacctccaacgcagagcaagagtcaattctggctttgagtgacatcctggagattccatgaaagaaagagaagcagaagctgaaatgaaggacatggagaattgtgtctttttcctttgataagctccactttgcaataaagatcttccccttcctgtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
position 575 583 589 592 596 618 621 625 695 702 706 709 712 744 747 750
NM_053577.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus secreted phosphoprotein 2 (Spp2), transcript variant X1, mRNA. (1169 bp)
gaagacacactggtcatgaacttagagttcaccgttcaggaaactacatgcctaagagagtctggtgatccctccacctgcgccttccaaaggggctactctgtgccaacagctgcttgcaggagcacagtgcagatgtccaagggacaggtgaaggatgtgtgggctcactgccgctgggcgtccacatccgagtccaacagcagtgaggagatgatttttggggacatggcaagatcccaccgacgaagaaatgattatctacttggctttctttatgatgaacccaaagagatcacgaggaggggacatcctcctgcccatagaaggttcctgaacctccaacgcagagcaagagtcaattctggctttgagtgacatcctggagattccatgaaagaaagagaagcagaagctgaaatgaaggacatggagaattgtgtctttttcctttgataagctccactttgcaataaagatcttccccttcctgta
position 892 900 906 909 913 935 938 942 985 992 996 999 1002 1034 1037 1040
XM_039084306.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/U19485_g_at
lang : en | div : | spe : rn | query_string : U19485_g_at | format : html | download :

0.000 | 0.000 | search_start;
0.235 | 0.235 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTTGGGGACATGGCAAGATCCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.275 | 0.040 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTGGCTTTGAGTGACATCCTGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.325 | 0.050 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCTTTGAGTGACATCCTGGAGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.334 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGCCCATAGAAGGTTCCTGAACCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.344 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTACTTGGCTTTCTTTATGATGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.354 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTTTCTTTATGATGAACCCAAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.365 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAAGATCCCACCGACGAAGAAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.375 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACATGGCAAGATCCCACCGACGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.385 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCACCGACGAAGAAATGATTATCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.392 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CATAGAAGGTTCCTGAACCTCCAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.401 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATTCTGGCTTTGAGTGACATCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.413 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCTCCTGCCCATAGAAGGTTCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.422 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGTTCCTGAACCTCCAACGCAGAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.431 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATCCCACCGACGAAGAAATGATT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.440 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAAGGTTCCTGAACCTCCAACGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.449 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTTGGCTTTCTTTATGATGAACCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.482 | 0.033 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTTTTGGGGACATGGCAAGATCCCA)%26(nt:TTCTGGCTTTGAGTGACATCCTGGA)%26(nt:TGGCTTTGAGTGACATCCTGGAGAT)%26(nt:TGCCCATAGAAGGTTCCTGAACCTC)%26(nt:TCTACTTGGCTTTCTTTATGATGAA)%26(nt:GGCTTTCTTTATGATGAACCCAAAG)%26(nt:GCAAGATCCCACCGACGAAGAAATG)%26(nt:GACATGGCAAGATCCCACCGACGAA)%26(nt:CCCACCGACGAAGAAATGATTATCT)%26(nt:CATAGAAGGTTCCTGAACCTCCAAC)%26(nt:CAATTCTGGCTTTGAGTGACATCCT)%26(nt:ATCCTCCTGCCCATAGAAGGTTCCT)%26(nt:AGGTTCCTGAACCTCCAACGCAGAG)%26(nt:AGATCCCACCGACGAAGAAATGATT)%26(nt:AGAAGGTTCCTGAACCTCCAACGCA)%26(nt:ACTTGGCTTTCTTTATGATGAACCC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.483 | 0.002 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]