GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-24 00:24:43, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant X1, mRNA. (1261 bp)
actcgggatgacctggccaggttaagaagtgatgggagtttgatgtttgaacaagtgcccatggtggagattgacgggatgaagctggtgcagaccaaagccattctcaactacattgccaccaaatacaacctctatgggaaggacatgaaggagagagccctcatcgacatgtatgcagaaggtgtggccgatctggagttgatggttctctattacccctacatgccccctggggagaaagaggcgagtcttgccaagatcaaggacaaagcaaggaaccgttacttccctgcctatgagaaggtgttgaagagccacggacaagattatctcgttggcaacaagctgagcagggctgatgtttccctggttgaacttctctaccatgtggaagagatggacccaggcattgtggacaacttccctctgctaaaggccctgagaaccagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctc...
position 474 479 480 481 482 483 491 492 493 494 495 687 688 689 690 691 693 694 695 696
Synonym: Gsta5; Yc2
XM_039084047.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 3, mRNA. (1370 bp)
actcgggatgacctggccaggttaagaagtgatgggagtttgatgtttgaacaagtgcccatggtggagattgacgggatgaagctggtgcagaccaaagccattctcaactacattgccaccaaatacaacctctatgggaaggacatgaaggagagagccctcatcgacatgtatgcagaaggtgtggccgatctggagttgatggttctctattacccctacatgccccctggggagaaagaggcgagtcttgccaagatcaaggacaaagcaaggaaccgttacttccctgcctatgagaaggtgttgaagagccacggacaagattatctcgttggcaacaagctgagcagggctgatgtttccctggttgaacttctctaccatgtggaagagatggacccaggcattgtggacaacttccctctgctaaaggccctgagaaccagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctc...
position 380 385 386 387 388 389 397 398 399 400 401 593 594 595 596 597 599 600 601 602
Synonym: Gsta5; Yc2
NM_001287025.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 2, mRNA. (1478 bp)
actcgggatgacctggccaggttaagaagtgatgggagtttgatgtttgaacaagtgcccatggtggagattgacgggatgaagctggtgcagaccaaagccattctcaactacattgccaccaaatacaacctctatgggaaggacatgaaggagagagccctcatcgacatgtatgcagaaggtgtggccgatctggagttgatggttctctattacccctacatgccccctggggagaaagaggcgagtcttgccaagatcaaggacaaagcaaggaaccgttacttccctgcctatgagaaggtgttgaagagccacggacaagattatctcgttggcaacaagctgagcagggctgatgtttccctggttgaacttctctaccatgtggaagagatggacccaggcattgtggacaacttccctctgctaaaggccctgagaaccagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctc...
position 488 493 494 495 496 497 505 506 507 508 509 701 702 703 704 705 707 708 709 710
Synonym: Gsta5; Yc2
NM_001159739.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 1, mRNA. (1508 bp)
actcgggatgacctggccaggttaagaagtgatgggagtttgatgtttgaacaagtgcccatggtggagattgacgggatgaagctggtgcagaccaaagccattctcaactacattgccaccaaatacaacctctatgggaaggacatgaaggagagagccctcatcgacatgtatgcagaaggtgtggccgatctggagttgatggttctctattacccctacatgccccctggggagaaagaggcgagtcttgccaagatcaaggacaaagcaaggaaccgttacttccctgcctatgagaaggtgttgaagagccacggacaagattatctcgttggcaacaagctgagcagggctgatgtttccctggttgaacttctctaccatgtggaagagatggacccaggcattgtggacaacttccctctgctaaaggccctgagaaccagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctc...
position 518 523 524 525 526 527 535 536 537 538 539 731 732 733 734 735 737 738 739 740
Synonym: Gsta5; Yc2
NM_001009920.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/S82820mRNA_s_at
lang : en | div : | spe : rn | query_string : S82820mRNA_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.093 | 0.093 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGATGGTTCTCTATTACCCCTACA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.103 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCCGATCTGGAGTTGATGGTTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.112 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGACCCAGGCATTGTGGACAACTT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.284 | 0.172 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGATGGTTCTCTATTACCCCTACAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.296 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGATGGTTCTCTATTACCCCTAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.305 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTGGCCGATCTGGAGTTGATGGTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.313 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCCGATCTGGAGTTGATGGTTCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.325 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACCCAGGCATTGTGGACAACTTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.338 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCGATCTGGAGTTGATGGTTCTCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.349 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GATGGACCCAGGCATTGTGGACAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.360 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGTTGATGGTTCTCTATTACCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.677 | 0.317 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GAGATGGACCCAGGCATTGTGGACA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.688 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACCCAGGCATTGTGGACAACTTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.700 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCGATCTGGAGTTGATGGTTCTCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.711 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTTGATGGTTCTCTATTACCCCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.720 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGGACCCAGGCATTGTGGACAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.729 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGAGATGGACCCAGGCATTGTGGAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.740 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCCAGGCATTGTGGACAACTTCCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.751 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGGTGTGGCCGATCTGGAGTTGAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.759 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAGAGATGGACCCAGGCATTGTGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.826 | 0.067 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGATGGTTCTCTATTACCCCTACA)%26(nt:TGGCCGATCTGGAGTTGATGGTTCT)%26(nt:TGGACCCAGGCATTGTGGACAACTT)%26(nt:TGATGGTTCTCTATTACCCCTACAT)%26(nt:GTTGATGGTTCTCTATTACCCCTAC)%26(nt:GTGGCCGATCTGGAGTTGATGGTTC)%26(nt:GGCCGATCTGGAGTTGATGGTTCTC)%26(nt:GGACCCAGGCATTGTGGACAACTTC)%26(nt:GCCGATCTGGAGTTGATGGTTCTCT)%26(nt:GATGGACCCAGGCATTGTGGACAAC)%26(nt:GAGTTGATGGTTCTCTATTACCCCT)%26(nt:GAGATGGACCCAGGCATTGTGGACA)%26(nt:GACCCAGGCATTGTGGACAACTTCC)%26(nt:CCGATCTGGAGTTGATGGTTCTCTA)%26(nt:AGTTGATGGTTCTCTATTACCCCTA)%26(nt:AGATGGACCCAGGCATTGTGGACAA)%26(nt:AGAGATGGACCCAGGCATTGTGGAC)%26(nt:ACCCAGGCATTGTGGACAACTTCCC)%26(nt:AAGGTGTGGCCGATCTGGAGTTGAT)%26(nt:AAGAGATGGACCCAGGCATTGTGGA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.831 | 0.005 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]