GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-23 22:30:32, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus chymotrypsin C (Ctrc), mRNA. (898 bp)
tggccttggcaggtctctctccagtacctcaaggacgacacatggaggcacacctgtgggggaagtctcatcaccaccagccacgtcctcactgccgcccactgcatcaacaaagacttcacttaccgtgtgggcctggggaagtataatctgacagtggaggatgaggaaggctccgtgtacgctgaggtggacaccatctacgtccatgagaagtggaaccgactcttcctgtggaacgacatcgctatcattaagttggctgagcctgtggaactgagcaacaccatccaggtggcctgcatcccagaggaaggttccctgctgcctcaggactatccctgctatgtcacgggctggggtcgcctctggaccaatggtcccatcgctgaagtgctccagcagggcctgcagcccatcgtgagccatgccacgtgctccaggttggactggtggttcatcaaggtccggaagacgatggtgtgcgctgggggtgatggcgtcatctctgcctgtaacggagattctggcggcccactgaactgccaagcagaagacggctcatggcaggtgcacggcatcgtgagcttcggttccagt...
position 324 333 373 380 394 405 412 424 431 448 459 490 497 511 518 534
NM_001077649.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/S80379_s_at
lang : en | div : | spe : rn | query_string : S80379_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.258 | 0.258 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGGTCGCCTCTGGACCAATGGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.274 | 0.016 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCGCTGAAGTGCTCCAGCAGGGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.282 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTTCCCTGCTGCCTCAGGACTATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.293 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGTCCCATCGCTGAAGTGCTCCAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.302 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGACACCATCTACGTCCATGAGAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.462 | 0.160 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGAACTGAGCAACACCATCCAGGTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.477 | 0.016 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTGAGCCTGTGGAACTGAGCAACA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.486 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTCTGGACCAATGGTCCCATCGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.500 | 0.015 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCCTCAGGACTATCCCTGCTATGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.514 | 0.014 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCAGGGCCTGCAGCCCATCGTGAGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.524 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACATCGCTATCATTAAGTTGGCTG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.535 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTATCATTAAGTTGGCTGAGCCTGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.546 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTACGTCCATGAGAAGTGGAACCGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.555 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCTGCATCCCAGAGGAAGGTTCCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.565 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAGGTGGCCTGCATCCCAGAGGAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.576 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGCAACACCATCCAGGTGGCCTGCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.692 | 0.116 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGGGTCGCCTCTGGACCAATGGTC)%26(nt:TCGCTGAAGTGCTCCAGCAGGGCCT)%26(nt:GGTTCCCTGCTGCCTCAGGACTATC)%26(nt:GGTCCCATCGCTGAAGTGCTCCAGC)%26(nt:GGACACCATCTACGTCCATGAGAAG)%26(nt:GGAACTGAGCAACACCATCCAGGTG)%26(nt:GCTGAGCCTGTGGAACTGAGCAACA)%26(nt:GCCTCTGGACCAATGGTCCCATCGC)%26(nt:GCCTCAGGACTATCCCTGCTATGTC)%26(nt:GCAGGGCCTGCAGCCCATCGTGAGC)%26(nt:GACATCGCTATCATTAAGTTGGCTG)%26(nt:CTATCATTAAGTTGGCTGAGCCTGT)%26(nt:CTACGTCCATGAGAAGTGGAACCGA)%26(nt:CCTGCATCCCAGAGGAAGGTTCCCT)%26(nt:CAGGTGGCCTGCATCCCAGAGGAAG)%26(nt:AGCAACACCATCCAGGTGGCCTGCA)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.693 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]