GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:21:53, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus myosin light chain 9 (Myl9), mRNA. (1008 bp)
tggcctccctggggaagaaccccacggatgagnacctggagggtatgatgaacgaggccccgggacctatcaacttcaccatgttcctcactatgtttggggagaagctgaacggcacagaccccgaggacgtgatccgcaatgcctttgcctgctttgatgaggaagcctcagggttcatccacgaggaccacctgcgggagctgctcaccaccatgggcgaccgattcacggatgaggaggtggacgagatgtaccgtgagcgcattgataagaagggcaacttcaactatgtggagttcactcgcatcctcaagcacggcgccaaggacaaagacgactaggctcttcttagctgtcccaatgcctacaccccatcccagtcacctcctcaacaacacatacactctaccctccccatgaggagttagggtcccggctcccagggcaggaaatgagccattaagacgcacagggtgaggctaggggttccaccacggacccaggcactagaggaagggccacagtggggaggtgagccaagggtggggccagctagcaccaaagtgaaggaagccactgaagatggccaccctcagc...
position 434 437 440 442 443 469 517 523 524 526 527 529 530 532 533 536
NM_001100885.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/S77900_at
lang : en | div : | spe : rn | query_string : S77900_at | format : html | download :

0.000 | 0.000 | search_start;
0.084 | 0.084 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAGCTGTCCCAATGCCTACAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.095 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTACCGTGAGCGCATTGATAAGAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.105 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TAGGCTCTTCTTAGCTGTCCCAATG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.114 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TACCGTGAGCGCATTGATAAGAAGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.125 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCTTCTTAGCTGTCCCAATGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.137 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACTAGGCTCTTCTTAGCTGTCCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.150 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACGACTAGGCTCTTCTTAGCTGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.159 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GACAAAGACGACTAGGCTCTTCTTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.170 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTTCTTAGCTGTCCCAATGCCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.180 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGGCTCTTCTTAGCTGTCCCAATGC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.190 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGATGTACCGTGAGCGCATTGATAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.199 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTAGGCTCTTCTTAGCTGTCCCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.209 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGAGATGTACCGTGAGCGCATTGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.217 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACGACTAGGCTCTTCTTAGCTGTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.227 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACCGTGAGCGCATTGATAAGAAGGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.236 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACTTCAACTATGTGGAGTTCACTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.258 | 0.021 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAGCTGTCCCAATGCCTACAC)%26(nt:TGTACCGTGAGCGCATTGATAAGAA)%26(nt:TAGGCTCTTCTTAGCTGTCCCAATG)%26(nt:TACCGTGAGCGCATTGATAAGAAGG)%26(nt:GCTCTTCTTAGCTGTCCCAATGCCT)%26(nt:GACTAGGCTCTTCTTAGCTGTCCCA)%26(nt:GACGACTAGGCTCTTCTTAGCTGTC)%26(nt:GACAAAGACGACTAGGCTCTTCTTA)%26(nt:CTCTTCTTAGCTGTCCCAATGCCTA)%26(nt:AGGCTCTTCTTAGCTGTCCCAATGC)%26(nt:AGATGTACCGTGAGCGCATTGATAA)%26(nt:ACTAGGCTCTTCTTAGCTGTCCCAA)%26(nt:ACGAGATGTACCGTGAGCGCATTGA)%26(nt:ACGACTAGGCTCTTCTTAGCTGTCC)%26(nt:ACCGTGAGCGCATTGATAAGAAGGG)%26(nt:AACTTCAACTATGTGGAGTTCACTC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.259 | 0.001 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]