GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-01-17 00:16:58, GGRNA : RefSeq release 203 (Nov, 2020)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant 2, mRNA. (2834 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1592 1595 1596 1597 1598 1599 1600 1601 1602 1605 1606 1607 1705 1707 1708 1709
Synonym: Cak; Drd1; PTK3D
NM_001166022.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant 1, mRNA. (2921 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1679 1682 1683 1684 1685 1686 1687 1688 1689 1692 1693 1694 1792 1794 1795 1796
Synonym: Cak; Drd1; PTK3D
NM_013137.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X7, mRNA. (2319 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1077 1080 1081 1082 1083 1084 1085 1086 1087 1090 1091 1092 1190 1192 1193 1194
Synonym: Cak; Drd1; PTK3D
XM_017601562.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X3, mRNA. (2918 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1676 1679 1680 1681 1682 1683 1684 1685 1686 1689 1690 1691 1789 1791 1792 1793
Synonym: Cak; Drd1; PTK3D
XM_017601558.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X4, mRNA. (2934 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1692 1695 1696 1697 1698 1699 1700 1701 1702 1705 1706 1707 1805 1807 1808 1809
Synonym: Cak; Drd1; PTK3D
XM_017601559.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X1, mRNA. (3135 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 1893 1896 1897 1898 1899 1900 1901 1902 1903 1906 1907 1908 2006 2008 2009 2010
Synonym: Cak; Drd1; PTK3D
XM_017601556.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X5, mRNA. (3448 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 2206 2209 2210 2211 2212 2213 2214 2215 2216 2219 2220 2221 2319 2321 2322 2323
Synonym: Cak; Drd1; PTK3D
XM_017601560.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
PREDICTED: Rattus norvegicus discoidin domain receptor tyrosine kinase 1 (Ddr1), transcript variant X2, mRNA. (3827 bp)
ggtggccatcatccttctcctcctccttatcattgccctgatgctctggaggctgcactggcgccggctgctcagcaaggcagagcgccgggtgttggaggaggagctgacggttcacctctctgtccctggggacaccatcctcatcaacaaccgcccagggccccgagagccacccccttaccaggaaccccggcctcgggggactccaactcactctgcgccctgcgtccccaatggctctgcgttgctgctctccaatccggcctaccgcctccttctggccacttacgcccgtccccctcgaggcccgggcccccccacacccgcctgggccaaacccaccaacacccaggcctgcagtggggactacatggagcccgagaagccgggcgccccacttctacccccacctccccagaacagcgtcccccattacgccgaggctgacattgtcaccctgcagggcgtcacagggggcaacacctacgctgttcccgcactgcccccaggggcggttggggatgggccccccagagtggatttccctcggtcacggctccgtttcaaggagaagctcggcgagggccaatttgggga...
position 2585 2588 2589 2590 2591 2592 2593 2594 2595 2598 2599 2600 2698 2700 2701 2702
Synonym: Cak; Drd1; PTK3D
XM_017601557.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/S77585_s_at
lang : en | div : | spe : rn | query_string : S77585_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.087 | 0.087 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCTCTGCGTTGCTGCTCTCCAAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.099 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCTGCGTTGCTGCTCTCCAATCCGG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.109 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GTTGCTGCTCTCCAATCCGGCCTAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.121 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GGCTCTGCGTTGCTGCTCTCCAATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.131 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCTCTGCGTTGCTGCTCTCCAATCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.142 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:GCGTTGCTGCTCTCCAATCCGGCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.152 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTGCGTTGCTGCTCTCCAATCCG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.162 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTTGCTGCTCTCCAATCCGGCCTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.174 | 0.012 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCCCAATGGCTCTGCGTTGCTGCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.184 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CCAACACCCAGGCCTGCAGTGGGGA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.195 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CACCCAGGCCTGCAGTGGGGACTAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.205 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAATGGCTCTGCGTTGCTGCTCTCC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.214 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATGGCTCTGCGTTGCTGCTCTCCAA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.226 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACACCCAGGCCTGCAGTGGGGACTA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.237 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATGGCTCTGCGTTGCTGCTCTCCA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.248 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACACCCAGGCCTGCAGTGGGGACT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.329 | 0.081 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGGCTCTGCGTTGCTGCTCTCCAAT)%26(nt:TCTGCGTTGCTGCTCTCCAATCCGG)%26(nt:GTTGCTGCTCTCCAATCCGGCCTAC)%26(nt:GGCTCTGCGTTGCTGCTCTCCAATC)%26(nt:GCTCTGCGTTGCTGCTCTCCAATCC)%26(nt:GCGTTGCTGCTCTCCAATCCGGCCT)%26(nt:CTCTGCGTTGCTGCTCTCCAATCCG)%26(nt:CGTTGCTGCTCTCCAATCCGGCCTA)%26(nt:CCCCAATGGCTCTGCGTTGCTGCTC)%26(nt:CCAACACCCAGGCCTGCAGTGGGGA)%26(nt:CACCCAGGCCTGCAGTGGGGACTAC)%26(nt:CAATGGCTCTGCGTTGCTGCTCTCC)%26(nt:ATGGCTCTGCGTTGCTGCTCTCCAA)%26(nt:ACACCCAGGCCTGCAGTGGGGACTA)%26(nt:AATGGCTCTGCGTTGCTGCTCTCCA)%26(nt:AACACCCAGGCCTGCAGTGGGGACT)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.336 | 0.007 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]