GGRNA ver.2 Help | Advanced search | Japanese    Previous release (v1)

2021-04-24 00:16:23, GGRNA : RefSeq release 205 (Mar, 2021)

Summary:

Results:

Matches are highlighted with green background. Overlapping matches are dark colored.

PREDICTED: Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant X1, mRNA. (1261 bp)
cagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctcagaaagctctgcaacaatgaagtattttgactaaatgttgaccgtacttattgggagggtaacatgttttctaaggcttctgtgttaattcatatagacatgactcatgaggaattgctgggatgccatctagttgagttaaaacctcaatctcgatcacttcctcggatattttcttaatgttcaataaaacaaaacaagcttcttagacgctggagtatccaaacattgtcatgaaatagctgtcatatccttgtcaaacagcgtcacgtagaaaccctcgtgtcaaactctcttacgcaaaagtaatctttccttatggagagtgtcctttctagtgaaatacacgcagacgtgtgtgcactcaaa
position 891 1026 1034 1039 1051 1095 1103 1109 1115 1130 1136 1142 1147 1168 1174 1185
Synonym: Gsta5; Yc2
XM_039084047.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 3, mRNA. (1370 bp)
cagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctcagaaagctctgcaacaatgaagtattttgactaaatgttgaccgtacttattgggagggtaacatgttttctaaggcttctgtgttaattcatatagacatgactcatgaggaattgctgggatgccatctagttgagttaaaacctcaatctcgatcacttcctcggatattttcttaatgttcaataaaacaaaacaagcttcttagacgctggagtatccaaacattgtcatgaaatagctgtcatatccttgtcaaacagcgtcacgtagaaaccctcgtgtcaaactctcttacgcaaaagtaatctttccttatggagagtgtcctttctagtgaaatacacgcagacgtgtgtgcactcaaactgtgaagaactgttttccttcaacttctgaatggttttcttattcaattactccgtcagtacatttatgtccaatatag...
position 797 932 940 945 957 1001 1009 1015 1021 1036 1042 1048 1053 1074 1080 1091
Synonym: Gsta5; Yc2
NM_001287025.1 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 2, mRNA. (1478 bp)
cagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctcagaaagctctgcaacaatgaagtattttgactaaatgttgaccgtacttattgggagggtaacatgttttctaaggcttctgtgttaattcatatagacatgactcatgaggaattgctgggatgccatctagttgagttaaaacctcaatctcgatcacttcctcggatattttcttaatgttcaataaaacaaaacaagcttcttagacgctggagtatccaaacattgtcatgaaatagctgtcatatccttgtcaaacagcgtcacgtagaaaccctcgtgtcaaactctcttacgcaaaagtaatctttccttatggagagtgtcctttctagtgaaatacacgcagacgtgtgtgcactcaaactgtgaagaactgttttccttcaacttctgaatggttttcttattcaattactccgtcagtacatttatgtccaatatag...
position 905 1040 1048 1053 1065 1109 1117 1123 1129 1144 1150 1156 1161 1182 1188 1199
Synonym: Gsta5; Yc2
NM_001159739.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)
Rattus norvegicus glutathione S-transferase alpha 3 (Gsta3), transcript variant 1, mRNA. (1508 bp)
cagagtcagcaacctccccacagtgaagaaatttcttcagcctggcagccagaggaagccttttgatgatgagaaatgtgtagaatcagcgaagaagatcttcagttaattcagtcagctatggatacactgtacccacaaagccagcctcagaaagctctgcaacaatgaagtattttgactaaatgttgaccgtacttattgggagggtaacatgttttctaaggcttctgtgttaattcatatagacatgactcatgaggaattgctgggatgccatctagttgagttaaaacctcaatctcgatcacttcctcggatattttcttaatgttcaataaaacaaaacaagcttcttagacgctggagtatccaaacattgtcatgaaatagctgtcatatccttgtcaaacagcgtcacgtagaaaccctcgtgtcaaactctcttacgcaaaagtaatctttccttatggagagtgtcctttctagtgaaatacacgcagacgtgtgtgcactcaaactgtgaagaactgttttccttcaacttctgaatggttttcttattcaattactccgtcagtacatttatgtccaatatag...
position 935 1070 1078 1083 1095 1139 1147 1153 1159 1174 1180 1186 1191 1212 1218 1229
Synonym: Gsta5; Yc2
NM_001009920.2 - Rattus norvegicus (Norway rat) - NCBI - UCSC - RefEx(expression)

Data Export:

Maximum 10000 results can be retrieved as Tab-delimited text or JSON format.

Debug Info:

Redirect URI : http://ggrna.dbcls.jp/rn/S72506_s_at
lang : en | div : | spe : rn | query_string : S72506_s_at | format : html | download :

0.000 | 0.000 | search_start;
0.091 | 0.091 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAGTTAAAACCTCAATCTCGATC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.316 | 0.225 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTCTTAGACGCTGGAGTATCCAAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.332 | 0.017 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCATATCCTTGTCAAACAGCGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.344 | 0.011 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TGTCAAACAGCGTCACGTAGAAACC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.352 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAGAAAGCTCTGCAACAATGAAGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.362 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TCAATCTCGATCACTTCCTCGGATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.371 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CTCTTACGCAAAAGTAATCTTTCCT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.379 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGTGTCAAACTCTCTTACGCAAAAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.540 | 0.161 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CGCTGGAGTATCCAAACATTGTCAT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.553 | 0.013 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:CAAACATTGTCATGAAATAGCTGTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.563 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ATCCTTGTCAAACAGCGTCACGTAG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.573 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AGTATCCAAACATTGTCATGAAATA)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.583 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:ACTTCCTCGGATATTTTCTTAATGT)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.592 | 0.010 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AATAGCTGTCATATCCTTGTCAAAC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.601 | 0.008 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AACCCTCGTGTCAAACTCTCTTACG)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.610 | 0.009 | count_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:AAACCTCAATCTCGATCACTTCCTC)?source=Rattus norvegicus (Norway rat)?to=0&format=json
0.672 | 0.062 | search_done; http://172.18.8.71:7700/v1/refseq/query?q=(nt:TTGAGTTAAAACCTCAATCTCGATC)%26(nt:TTCTTAGACGCTGGAGTATCCAAAC)%26(nt:TGTCATATCCTTGTCAAACAGCGTC)%26(nt:TGTCAAACAGCGTCACGTAGAAACC)%26(nt:TCAGAAAGCTCTGCAACAATGAAGT)%26(nt:TCAATCTCGATCACTTCCTCGGATA)%26(nt:CTCTTACGCAAAAGTAATCTTTCCT)%26(nt:CGTGTCAAACTCTCTTACGCAAAAG)%26(nt:CGCTGGAGTATCCAAACATTGTCAT)%26(nt:CAAACATTGTCATGAAATAGCTGTC)%26(nt:ATCCTTGTCAAACAGCGTCACGTAG)%26(nt:AGTATCCAAACATTGTCATGAAATA)%26(nt:ACTTCCTCGGATATTTTCTTAATGT)%26(nt:AATAGCTGTCATATCCTTGTCAAAC)%26(nt:AACCCTCGTGTCAAACTCTCTTACG)%26(nt:AAACCTCAATCTCGATCACTTCCTC)?source=Rattus norvegicus (Norway rat)?to=49?from=0?snippet=full_search?drilldown=source?get=accession,version,gi,length,symbol,synonym,geneid,division,source,definition&format=json
0.676 | 0.004 | cgi_end;

GGRNA ver.2 by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 4.0 International License (CC BY 4.0).

If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596. [Full Text]