LOCUS       NR_132743                445 bp    RNA     linear   ROD 04-FEB-2021
DEFINITION  Rattus norvegicus mitoregulin (Mtln), long non-coding RNA.
ACCESSION   NR_132743
VERSION     NR_132743.1
KEYWORDS    RefSeq.
SOURCE      Rattus norvegicus (Norway rat)
  ORGANISM  Rattus norvegicus
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha;
            Muroidea; Muridae; Murinae; Rattus.
REFERENCE   1  (bases 1 to 445)
  AUTHORS   Stein CS, Jadiya P, Zhang X, McLendon JM, Abouassaly GM, Witmer NH,
            Anderson EJ, Elrod JW and Boudreau RL.
  TITLE     Mitoregulin: A lncRNA-Encoded Microprotein that Supports
            Mitochondrial Supercomplexes and Respiratory Efficiency
  JOURNAL   Cell Rep 23 (13), 3710-3720 (2018)
   PUBMED   29949756
REFERENCE   2  (bases 1 to 445)
  AUTHORS   Crappe J, Van Criekinge W, Trooskens G, Hayakawa E, Luyten W,
            Baggerman G and Menschaert G.
  TITLE     Combining in silico prediction and ribosome profiling in a
            genome-wide search for novel putatively coding sORFs
  JOURNAL   BMC Genomics 14, 648 (2013)
   PUBMED   24059539
  REMARK    Publication Status: Online-Only
REFERENCE   3  (bases 1 to 445)
  AUTHORS   Xiao HS, Huang QH, Zhang FX, Bao L, Lu YJ, Guo C, Yang L, Huang WJ,
            Fu G, Xu SH, Cheng XP, Yan Q, Zhu ZD, Zhang X, Chen Z, Han ZG and
            Zhang X.
  TITLE     Identification of gene expression profile of dorsal root ganglion
            in the rat peripheral axotomy model of neuropathic pain
  JOURNAL   Proc Natl Acad Sci U S A 99 (12), 8360-8365 (2002)
   PUBMED   12060780
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            JACYVU010000118.1.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments.
            
            ##Evidence-Data-START##
            Transcript exon combination :: FQ212323.1, AI639093.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           SAMN06621351, SAMN16676808
                                           [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-358               JACYVU010000118.1  38886376-38886733   c
            359-445             JACYVU010000118.1  38885875-38885961   c
FEATURES             Location/Qualifiers
     source          1..445
                     /organism="Rattus norvegicus"
                     /mol_type="transcribed RNA"
                     /strain="BN"
                     /db_xref="taxon:10116"
                     /chromosome="3"
                     /map="3q36"
     gene            1..445
                     /gene="Mtln"
                     /gene_synonym="Smim37"
                     /note="mitoregulin"
                     /db_xref="GeneID:106631776"
                     /db_xref="RGD:10401149"
     ncRNA           1..445
                     /ncRNA_class="lncRNA"
                     /gene="Mtln"
                     /gene_synonym="Smim37"
                     /product="mitoregulin"
                     /db_xref="GeneID:106631776"
                     /db_xref="RGD:10401149"
     exon            1..358
                     /gene="Mtln"
                     /gene_synonym="Smim37"
                     /inference="alignment:Splign:2.1.0"
     exon            359..445
                     /gene="Mtln"
                     /gene_synonym="Smim37"
                     /inference="alignment:Splign:2.1.0"
ORIGIN      

atctactgcatgctgagcgtttgcaatggcggacgtgtctgagaggacgctgcaagtgtccgtgctagtggctttcgcctctggagtggtccttggctggcaagcgaatcggttgcggaggcgttacctggactggaggaagcggaggctgcaggacaagctggcgacgactcagaaaaagctggacctggcctgagcacgttgggttctctccaagcctcgtgcagcccgtatccggggagctgcgcgactacacgccctgagtcccggctcgtccttgcacggcttgcaggaacgtggcttgcttccagacctcagaaagaaaatagttttgtcttcgctaacagcctgtgctcagcttgtcgaagatggatataaagcacgggaaagaaaacatttcttgcactttatgaatctatttttaaaataaaaaattttaaacatc

//