2024-05-04 19:18:27, GGRNA.v2 : RefSeq release 222 (Jan, 2024)
LOCUS NR_132743 445 bp RNA linear ROD 04-FEB-2021 DEFINITION Rattus norvegicus mitoregulin (Mtln), long non-coding RNA. ACCESSION NR_132743 VERSION NR_132743.1 KEYWORDS RefSeq. SOURCE Rattus norvegicus (Norway rat) ORGANISM Rattus norvegicus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Rattus. REFERENCE 1 (bases 1 to 445) AUTHORS Stein CS, Jadiya P, Zhang X, McLendon JM, Abouassaly GM, Witmer NH, Anderson EJ, Elrod JW and Boudreau RL. TITLE Mitoregulin: A lncRNA-Encoded Microprotein that Supports Mitochondrial Supercomplexes and Respiratory Efficiency JOURNAL Cell Rep 23 (13), 3710-3720 (2018) PUBMED 29949756 REFERENCE 2 (bases 1 to 445) AUTHORS Crappe J, Van Criekinge W, Trooskens G, Hayakawa E, Luyten W, Baggerman G and Menschaert G. TITLE Combining in silico prediction and ribosome profiling in a genome-wide search for novel putatively coding sORFs JOURNAL BMC Genomics 14, 648 (2013) PUBMED 24059539 REMARK Publication Status: Online-Only REFERENCE 3 (bases 1 to 445) AUTHORS Xiao HS, Huang QH, Zhang FX, Bao L, Lu YJ, Guo C, Yang L, Huang WJ, Fu G, Xu SH, Cheng XP, Yan Q, Zhu ZD, Zhang X, Chen Z, Han ZG and Zhang X. TITLE Identification of gene expression profile of dorsal root ganglion in the rat peripheral axotomy model of neuropathic pain JOURNAL Proc Natl Acad Sci U S A 99 (12), 8360-8365 (2002) PUBMED 12060780 COMMENT VALIDATED REFSEQ: This record has undergone validation or preliminary review. The reference sequence was derived from JACYVU010000118.1. Sequence Note: This RefSeq record was created from genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. ##Evidence-Data-START## Transcript exon combination :: FQ212323.1, AI639093.1 [ECO:0000332] RNAseq introns :: single sample supports all introns SAMN06621351, SAMN16676808 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-358 JACYVU010000118.1 38886376-38886733 c 359-445 JACYVU010000118.1 38885875-38885961 c FEATURES Location/Qualifiers source 1..445 /organism="Rattus norvegicus" /mol_type="transcribed RNA" /strain="BN" /db_xref="taxon:10116" /chromosome="3" /map="3q36" gene 1..445 /gene="Mtln" /gene_synonym="Smim37" /note="mitoregulin" /db_xref="GeneID:106631776" /db_xref="RGD:10401149" ncRNA 1..445 /ncRNA_class="lncRNA" /gene="Mtln" /gene_synonym="Smim37" /product="mitoregulin" /db_xref="GeneID:106631776" /db_xref="RGD:10401149" exon 1..358 /gene="Mtln" /gene_synonym="Smim37" /inference="alignment:Splign:2.1.0" exon 359..445 /gene="Mtln" /gene_synonym="Smim37" /inference="alignment:Splign:2.1.0" ORIGIN
atctactgcatgctgagcgtttgcaatggcggacgtgtctgagaggacgctgcaagtgtccgtgctagtggctttcgcctctggagtggtccttggctggcaagcgaatcggttgcggaggcgttacctggactggaggaagcggaggctgcaggacaagctggcgacgactcagaaaaagctggacctggcctgagcacgttgggttctctccaagcctcgtgcagcccgtatccggggagctgcgcgactacacgccctgagtcccggctcgtccttgcacggcttgcaggaacgtggcttgcttccagacctcagaaagaaaatagttttgtcttcgctaacagcctgtgctcagcttgtcgaagatggatataaagcacgggaaagaaaacatttcttgcactttatgaatctatttttaaaataaaaaattttaaacatc
//
by
@meso_cacase at
DBCLS
This page is licensed under a
Creative Commons Attribution 4.0 International License (CC BY 4.0).
If you use GGRNA in your work, please cite:
Naito Y, Bono H. (2012)
GGRNA: an ultrafast, transcript-oriented search engine for genes and transcripts.
Nucleic Acids Res., 40, W592-W596.
[Full Text]